ID: 1115903726

View in Genome Browser
Species Human (GRCh38)
Location 14:38183900-38183922
Sequence AACCCCCTCTCTAAATCACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 128}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115903726_1115903730 12 Left 1115903726 14:38183900-38183922 CCATGTGATTTAGAGAGGGGGTT 0: 1
1: 0
2: 1
3: 14
4: 128
Right 1115903730 14:38183935-38183957 GTGTAAGCTAGATCTCTTGAGGG 0: 1
1: 0
2: 2
3: 10
4: 123
1115903726_1115903733 23 Left 1115903726 14:38183900-38183922 CCATGTGATTTAGAGAGGGGGTT 0: 1
1: 0
2: 1
3: 14
4: 128
Right 1115903733 14:38183946-38183968 ATCTCTTGAGGGGCTGGAAATGG 0: 1
1: 0
2: 2
3: 14
4: 216
1115903726_1115903729 11 Left 1115903726 14:38183900-38183922 CCATGTGATTTAGAGAGGGGGTT 0: 1
1: 0
2: 1
3: 14
4: 128
Right 1115903729 14:38183934-38183956 AGTGTAAGCTAGATCTCTTGAGG 0: 1
1: 0
2: 1
3: 3
4: 91
1115903726_1115903732 17 Left 1115903726 14:38183900-38183922 CCATGTGATTTAGAGAGGGGGTT 0: 1
1: 0
2: 1
3: 14
4: 128
Right 1115903732 14:38183940-38183962 AGCTAGATCTCTTGAGGGGCTGG 0: 1
1: 0
2: 1
3: 12
4: 145
1115903726_1115903731 13 Left 1115903726 14:38183900-38183922 CCATGTGATTTAGAGAGGGGGTT 0: 1
1: 0
2: 1
3: 14
4: 128
Right 1115903731 14:38183936-38183958 TGTAAGCTAGATCTCTTGAGGGG 0: 1
1: 0
2: 1
3: 7
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115903726 Original CRISPR AACCCCCTCTCTAAATCACA TGG (reversed) Intergenic
900942595 1:5810701-5810723 AACCCCCTCCCTGCAGCACAAGG + Intergenic
904243514 1:29167980-29168002 AATCCCAGCTCTAAACCACAAGG + Intronic
909484499 1:76158215-76158237 AACCACCTGTTCAAATCACATGG - Intronic
911129375 1:94373513-94373535 AACCCCCTTTAAATATCACAAGG - Intergenic
912164091 1:107021739-107021761 ACCCCCTACTCTAAATCACATGG + Intergenic
914461274 1:147887804-147887826 AAGCCAGTCTCTAAATCATATGG - Intergenic
915590284 1:156866656-156866678 AACCCCCTCTCCAGACCCCAGGG - Intronic
915778647 1:158520902-158520924 AATCTCCTATCTAAATCTCAAGG - Intergenic
916450899 1:164919459-164919481 AGCCCTCTCTCTTAAACACAAGG + Intergenic
917441340 1:175071555-175071577 AACCCTCTCTTAAAAACACATGG + Intronic
919171999 1:193966617-193966639 AAAGCCCTTTCTAAATGACATGG + Intergenic
922511164 1:226169222-226169244 AAAAAACTCTCTAAATCACAAGG - Intronic
924622627 1:245675347-245675369 AGCCCCTGCCCTAAATCACATGG + Intronic
1063183606 10:3630379-3630401 CACCGCCTCTCTGAGTCACATGG + Intergenic
1065720183 10:28621143-28621165 AAACACCTTTCTAAATCAGATGG - Intronic
1065770915 10:29077724-29077746 AACTCCCTCTCTTACTCAGATGG - Intergenic
1067011375 10:42717186-42717208 AACCCCCACTCTATATCACGTGG + Intergenic
1067312211 10:45124655-45124677 AACCCCCACTCTATATCACGTGG - Intergenic
1067813987 10:49457498-49457520 ACCCTCCTCTCTGAGTCACATGG + Exonic
1068961076 10:62867222-62867244 AACCTCATCTCAGAATCACACGG - Intronic
1069931570 10:71885896-71885918 AACCCCATCTCTAAAAAAAAAGG - Intergenic
1076131731 10:128018231-128018253 AACCTCACCTCTAAATCGCACGG + Intronic
1077206780 11:1348649-1348671 CACCCTCTCTCTGTATCACAGGG + Intergenic
1077519316 11:3022415-3022437 AAACCCCTCCCCAAATCTCAGGG + Intronic
1078140040 11:8685578-8685600 AACCCACTTTCTAAATCCCTAGG - Intronic
1084113600 11:67028958-67028980 AACCACCTCTCTGAACTACAAGG + Intronic
1084589046 11:70079488-70079510 GCCCCCCTCTCTAAAACATAGGG - Intronic
1087500059 11:98939479-98939501 TACCCACTCTCTATTTCACAGGG + Intergenic
1088964483 11:114704180-114704202 AATCCCTTCTCTAAAACCCAAGG - Intronic
1089317717 11:117603353-117603375 AACCCCACGTGTAAATCACATGG + Intronic
1091175994 11:133558418-133558440 AAACACCTCTAGAAATCACATGG + Intergenic
1092007974 12:5085639-5085661 CACCCACTCCCCAAATCACAAGG - Intergenic
1094196656 12:27756999-27757021 AGCCCCCACCCTAAATCACATGG - Intergenic
1094502028 12:31030285-31030307 AAACCCCTTGCTAACTCACAGGG + Intergenic
1096592058 12:52666855-52666877 AAGCCCATCTCTAAAAAACATGG + Intergenic
1098972152 12:76868067-76868089 AAGCACTTCTCTAAACCACATGG - Intronic
1102858716 12:116317148-116317170 GACCCCATCTCTAAAACAAAAGG + Intergenic
1104287699 12:127440110-127440132 AAGCACCACCCTAAATCACATGG + Intergenic
1104750609 12:131235903-131235925 AACCCCCTCTCACGGTCACACGG + Intergenic
1104799791 12:131546840-131546862 AAACCTGTCTCTAAATCCCAGGG - Intergenic
1106644188 13:31615189-31615211 GACCCCATCCCTTAATCACATGG + Intergenic
1106696323 13:32177688-32177710 AGCCATCTCTCTAAATCAAAGGG + Intronic
1107890656 13:44911328-44911350 AGCCCCCACTCTAAGGCACATGG - Intergenic
1110405919 13:75150360-75150382 AACCCTCTCTCCAAGTGACATGG - Intergenic
1111548270 13:89773360-89773382 AACCTCTTCTCTAAATGAGATGG + Intergenic
1115632115 14:35255472-35255494 AACCTCCTCTGTAAGTCACTAGG - Intronic
1115903726 14:38183900-38183922 AACCCCCTCTCTAAATCACATGG - Intergenic
1115962332 14:38849634-38849656 GAGCCCCTCTCTAATACACAAGG - Intergenic
1116605854 14:46993994-46994016 AGCCTCCTCCCTAAATCACATGG - Intronic
1118454593 14:65932865-65932887 GACCCCTGCTCTAAATCTCATGG - Intergenic
1121038208 14:90724146-90724168 ACTCCCCTTTCCAAATCACATGG + Intronic
1121607586 14:95252649-95252671 AACCTCCACTCTAAATCACAGGG - Intronic
1122877677 14:104676462-104676484 AAGACCCTTTCTAAAACACAAGG - Intergenic
1125142737 15:36428683-36428705 AGCCTCCTCTGTATATCACAGGG + Intergenic
1129243659 15:74267158-74267180 CACCCCCTCTCTAATCCTCAAGG + Intronic
1130049738 15:80473866-80473888 AAACCCCACTGTAAAGCACATGG - Intronic
1131366755 15:91847985-91848007 AACCCACTCTCCAAATATCAAGG + Intergenic
1133741254 16:8653255-8653277 AACCCTCTGTTAAAATCACAAGG + Intergenic
1134114243 16:11536177-11536199 AACCCCCTCTGGAGATCACAGGG + Intergenic
1138069774 16:53981314-53981336 GACCCCATCTCTAAAACAAATGG + Intronic
1140226918 16:73085418-73085440 AACCCCATCTCTAAATTAGCTGG - Intergenic
1141563630 16:84886646-84886668 AACCCCATCTCTAAAGAAAATGG + Intronic
1143326823 17:6104501-6104523 ATCTGCCTCTCCAAATCACAAGG + Intronic
1148920182 17:51024549-51024571 AACTCCGTCTCTAAATCAGCCGG + Intronic
1152437700 17:80286397-80286419 AACCCCTTCTCTATCACACATGG - Intronic
1158130407 18:54146759-54146781 AATCCCCACCCTAACTCACATGG - Intergenic
1161022904 19:2019396-2019418 ACACCCCTCTCAAAATCACATGG - Intronic
1163808675 19:19416459-19416481 AACCCCCTCTGTATTTCCCAAGG - Intronic
926784940 2:16509379-16509401 AAGGCTATCTCTAAATCACAGGG + Intergenic
926821694 2:16858639-16858661 AAACCACTCTAAAAATCACATGG - Intergenic
928194938 2:29208754-29208776 GACCCCTTCCCTAACTCACAGGG - Intronic
933807990 2:86013975-86013997 ACACCCCTCTCTAAATGCCATGG - Intergenic
936160211 2:110079197-110079219 AACCCACTGTCTACATCTCAGGG - Intergenic
936271595 2:111053495-111053517 AAGCCTCTCCCTCAATCACATGG + Intronic
938143887 2:128818379-128818401 AACCCTCTCTTGAAATCAAAAGG + Intergenic
939095782 2:137831723-137831745 AACCCCATCTCTAAATTAGCTGG - Intergenic
941792477 2:169567755-169567777 AACTCTCCCTCTAAATCAAATGG - Intronic
943749921 2:191500631-191500653 AACCCCAGCTCTAAAGCACAGGG + Intergenic
946386174 2:219385817-219385839 AGCCCACTCCCCAAATCACAAGG + Intronic
947732330 2:232438345-232438367 AAGCCCCTCTCTCAATGGCAGGG + Intergenic
1172197210 20:33100087-33100109 AACACCCTCTATAAATCATGGGG + Intronic
1172227454 20:33314685-33314707 GACCCACTCTCAAAATCACAGGG + Intergenic
1173468252 20:43301552-43301574 GACCCCCCCTCTAAGTTACAAGG - Intergenic
1175017163 20:55804045-55804067 AACAGCCTCACTCAATCACAAGG + Intergenic
1176964433 21:15195664-15195686 ATACCCTTCTCTAATTCACATGG - Intergenic
1179139334 21:38710419-38710441 TTCCCCCACACTAAATCACATGG - Intergenic
1181622918 22:24103159-24103181 AACACACTCTCCAAATCACAGGG - Intronic
1183722183 22:39568960-39568982 GACCCCATCTCTCAATCCCACGG + Intergenic
949578779 3:5365644-5365666 AACCCCTACCCTAGATCACATGG - Intergenic
949782591 3:7706859-7706881 AACCACCACCCTAAATCGCATGG + Intronic
950931549 3:16793646-16793668 AACCCCCTCTGAGAATCAGAAGG - Intergenic
955675296 3:61442079-61442101 GATCCCCTCTCTAAGTCATATGG + Intergenic
956607982 3:71092293-71092315 AACCTCCTCCCTAACTCACCAGG - Intronic
958028201 3:88074218-88074240 ATACCCATCTCTAAATCATAGGG - Intronic
959195140 3:103170804-103170826 AGCCCCAACTCTTAATCACATGG - Intergenic
960551749 3:118983802-118983824 ATCCCACTCCATAAATCACAGGG + Intronic
961137345 3:124524102-124524124 GAACCACTCCCTAAATCACATGG + Intronic
962068754 3:132011225-132011247 AAACCCCTTTCTAAAGCACAAGG - Intronic
968077188 3:195822591-195822613 CTCCCCATCTCGAAATCACAGGG - Intergenic
971832753 4:31718808-31718830 AACTGCCTCTCTTATTCACAAGG + Intergenic
975458826 4:74626634-74626656 ACACCCATCTCTAAATCAGAAGG - Intergenic
982705043 4:158699393-158699415 AACCCCATCTCTACAACAAATGG + Intronic
1202755198 4_GL000008v2_random:55410-55432 AACCACCTTTCTAAATGTCATGG - Intergenic
985963328 5:3320391-3320413 CACCCCCTTTCTAAAGCCCAGGG + Intergenic
988415911 5:30947058-30947080 ACCTCCATCTCTAAAGCACAAGG - Intergenic
988680326 5:33478677-33478699 AACACCATTTCTAAATCACCTGG + Intergenic
989265002 5:39463425-39463447 AAGCCCTTCTCTAAACCACCGGG + Intergenic
992751896 5:79869987-79870009 AACCCTCTCTCTGATTCACCAGG - Intergenic
994294457 5:98073533-98073555 AACCCCCATCCTAAATCACATGG + Intergenic
994335208 5:98556738-98556760 AGCCCCCAGCCTAAATCACATGG - Intergenic
995827922 5:116322004-116322026 AATCCCCTGCCTAAATCCCATGG - Intronic
998545161 5:143021528-143021550 AACCCTCTCTCTAATCCACGTGG - Intronic
1001325659 5:170721950-170721972 ACCTCCCCCTCTAAATCTCAAGG + Intronic
1001973257 5:175974226-175974248 AACGCCTTCTTAAAATCACAAGG + Intronic
1002244180 5:177869557-177869579 AACGCCTTCTTAAAATCACAAGG - Intergenic
1003525481 6:6893249-6893271 AACCCCTTGGCTAACTCACAGGG - Intergenic
1005405953 6:25488265-25488287 AACCCCCTCACTGAATCAGAAGG - Intronic
1006711480 6:36076153-36076175 AACCCAATTGCTAAATCACAAGG - Intronic
1008938020 6:57013509-57013531 AACTCAGTCTCTAAATCATATGG + Intronic
1009804066 6:68579322-68579344 AACCCCATCTCTAAATAGCTGGG + Intergenic
1011432108 6:87298513-87298535 AAATCCAACTCTAAATCACATGG + Intronic
1018173986 6:161163557-161163579 AACCCCCTCCCCATGTCACAGGG - Intronic
1018909682 6:168094897-168094919 AACCCCTTCTGTAACTCACCAGG + Intergenic
1019658553 7:2210877-2210899 CAGCCCCTCTCCAACTCACAGGG + Intronic
1019904113 7:4047954-4047976 GGCCCCCTCTCTAAGTCACCAGG - Intronic
1028763230 7:94519299-94519321 ATTCCCCTCTCCCAATCACATGG - Intronic
1028953958 7:96667721-96667743 AACCACATTGCTAAATCACATGG + Intronic
1031070941 7:117160921-117160943 AACCTACTCTCTAAAACTCATGG + Intronic
1031362403 7:120862398-120862420 CAGCCCTTCTCTAAAGCACAGGG + Intergenic
1044235673 8:89827192-89827214 AACCCCATCTCTAAATTAGCCGG - Intergenic
1048574610 8:135680897-135680919 AACCCCGGCTCTGCATCACAAGG - Intergenic
1050909738 9:11053847-11053869 AATGCCCTCTCTATACCACAAGG + Intergenic
1052230348 9:26143312-26143334 AACCCCCTATCAAACTCAAAGGG + Intergenic
1053158105 9:35793818-35793840 AGCCCCCTCTCTGAATCACTGGG - Intronic
1057579967 9:96279015-96279037 AACCTTCTAGCTAAATCACATGG + Intronic
1058929342 9:109703662-109703684 AACCCATTCTCTAAAAGACAGGG + Intronic
1059434541 9:114268067-114268089 AACTCCCTCTTTGAATGACAGGG - Intronic
1060228803 9:121812415-121812437 AGCCCCCTCTCTAGGCCACATGG + Intergenic
1062261538 9:135665446-135665468 AACCACCTCTCCAAACCCCAGGG - Intronic
1185629023 X:1502633-1502655 AACCCCCTCCCCAAATAGCAGGG - Intronic
1189276807 X:39792434-39792456 AACCTCATCTCTAAATAACTAGG + Intergenic
1194884368 X:99294866-99294888 TACCCCATCTATAAACCACAGGG + Intergenic
1198633278 X:138666632-138666654 AAGCCCTTCTCTATCTCACAAGG + Intronic
1201551019 Y:15216489-15216511 ATGCCTCTATCTAAATCACATGG - Intergenic