ID: 1115903731

View in Genome Browser
Species Human (GRCh38)
Location 14:38183936-38183958
Sequence TGTAAGCTAGATCTCTTGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 73}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115903726_1115903731 13 Left 1115903726 14:38183900-38183922 CCATGTGATTTAGAGAGGGGGTT 0: 1
1: 0
2: 1
3: 14
4: 128
Right 1115903731 14:38183936-38183958 TGTAAGCTAGATCTCTTGAGGGG 0: 1
1: 0
2: 1
3: 7
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115903731 Original CRISPR TGTAAGCTAGATCTCTTGAG GGG Intergenic
902662215 1:17913122-17913144 TGAAAGCTAGATCTGGGGAGGGG + Intergenic
903396890 1:23008354-23008376 TGAAAGCTAGATCTCTGGAGAGG - Intergenic
903872056 1:26442985-26443007 TGTTAGTTAGATATCTTGGGTGG + Intronic
909478532 1:76109707-76109729 TGTAAGCCCGAGCTCTTGTGTGG - Intronic
922379096 1:225003358-225003380 TATAAGATAGCTCTTTTGAGTGG + Intronic
923351027 1:233106840-233106862 TGTAAGTTAGATATCCAGAGAGG - Intronic
1068021637 10:51592809-51592831 TGTATGCTACATCTCATGAAGGG + Intronic
1069463636 10:68618186-68618208 TATAAACTAGATTTCATGAGTGG - Intronic
1084386084 11:68843441-68843463 TGTAGGATAGATCCCTGGAGGGG + Intronic
1089823292 11:121247620-121247642 TCTAAGGTAGATCTCTGGAAAGG + Intergenic
1090981119 11:131723355-131723377 CGTAATCTACATCGCTTGAGCGG - Intronic
1091957358 12:4657992-4658014 TGTCAGCTACATCTCCTCAGGGG - Intronic
1092223873 12:6733778-6733800 GGTAAGCTTGTTGTCTTGAGCGG + Intergenic
1093303132 12:17478546-17478568 TGTACAATATATCTCTTGAGGGG + Intergenic
1109530019 13:63630890-63630912 TGAAGGCTAAATCTCTTGACAGG + Intergenic
1109841946 13:67929533-67929555 TGAAAGCTATATATCTTCAGGGG - Intergenic
1112222055 13:97500943-97500965 TAGAAGCTAGATCTCTTGAATGG - Intergenic
1114362278 14:21987785-21987807 TGTAAGCTAGATCTTGTGCTAGG - Intergenic
1115104385 14:29743096-29743118 TTTAAGCAAGATATTTTGAGAGG + Intronic
1115903731 14:38183936-38183958 TGTAAGCTAGATCTCTTGAGGGG + Intergenic
1119535081 14:75396313-75396335 TGTAAAATAGAGCTGTTGAGAGG + Intergenic
1123678350 15:22735944-22735966 TGGAAGCTAGATTTCTTGATGGG + Intergenic
1124330540 15:28810213-28810235 TGGAAGCTAGAGTTCTTGATGGG + Intergenic
1132983079 16:2749236-2749258 TGCAAGCAGGGTCTCTTGAGAGG - Intergenic
1139122426 16:64036742-64036764 TGTAAACTAGATTTGTTGACAGG + Intergenic
1141093819 16:81148598-81148620 TGTCAGCTTGACCTCTAGAGGGG + Intergenic
1144164712 17:12598834-12598856 TGTAAGCAAAATCTGTTGAAAGG - Intergenic
1158871877 18:61696127-61696149 TGTAAGGTACATCTCTTTACTGG - Intergenic
1159124370 18:64206435-64206457 AGTAAGCTAGATGGATTGAGTGG - Intergenic
1160341078 18:78089265-78089287 TGAAAGCTAGACCTCCTGGGAGG + Intergenic
1167670420 19:50849662-50849684 TATCAGCTAGATTTCTAGAGGGG - Intergenic
925191111 2:1884433-1884455 GGTCAGCAAGATCTGTTGAGTGG - Intronic
925525722 2:4798624-4798646 TGTCTGCTAGAGCCCTTGAGGGG - Intergenic
925538308 2:4939652-4939674 TGTAACCTAGACCCCTTGAATGG + Intergenic
929018199 2:37523271-37523293 TGTAAATTAGATCTCTACAGAGG + Intergenic
933532879 2:83532876-83532898 TGTTAGCTTGATCTCCTGAGAGG + Intergenic
935682597 2:105651114-105651136 TGCAACCTAGATCTCTTGTGTGG + Intergenic
940063664 2:149601236-149601258 TGCAAGCCAGATGTATTGAGAGG - Intergenic
940117175 2:150221825-150221847 TGTATGCTAGATGTCTTCATTGG + Intergenic
943685680 2:190815497-190815519 AGTCAGCCAGATCTCATGAGTGG - Intergenic
945017870 2:205538705-205538727 TGTAAGCCAGATCTGCTCAGGGG + Intronic
945076556 2:206045696-206045718 TTTAGGCTAGATCTCCTGAGGGG - Intronic
945143551 2:206713318-206713340 TGTACAGTAGATCTCTTGATTGG + Intronic
946415230 2:219536879-219536901 TGTTAGCTTCATCTTTTGAGGGG - Intronic
948897661 2:240934798-240934820 TGCAAGCCAGAGCTCTTGGGCGG - Intronic
1169355821 20:4904169-4904191 TGTCAGCTTGACCTCTGGAGGGG + Intronic
1177377634 21:20293877-20293899 TGTATTGTAGATTTCTTGAGTGG + Intergenic
1177895605 21:26853292-26853314 TGCCAGCTGGCTCTCTTGAGTGG - Intergenic
1179053220 21:37906981-37907003 TTGAAACTAGATTTCTTGAGAGG + Intronic
1182517579 22:30867808-30867830 TGTAAGCAAGAGCTGGTGAGAGG - Intronic
1184896720 22:47411867-47411889 TGAAAACTACATCACTTGAGAGG + Intergenic
949672716 3:6417883-6417905 TGAAAGCCAGCTCTCTTGAGAGG + Intergenic
953784746 3:45902714-45902736 TGTAGGCTTGTTCTGTTGAGTGG + Exonic
955027947 3:55188564-55188586 TTTAAGATGGATTTCTTGAGAGG + Intergenic
955537357 3:59938462-59938484 TGTATGTTAGATCTCTAGACTGG - Intronic
964699479 3:159549070-159549092 TGCAAACTCTATCTCTTGAGTGG + Intronic
964742046 3:159976497-159976519 TGTAATATAGATCTCTTTTGGGG - Intergenic
977237115 4:94521601-94521623 TACATACTAGATCTCTTGAGAGG - Intronic
977306963 4:95335763-95335785 TGTATGTTAGATCTATTGACTGG + Intronic
981550970 4:145940409-145940431 GGGAAGCTAGATCTTTTGGGGGG - Intergenic
981955689 4:150470315-150470337 GGTAAGTCAGATGTCTTGAGAGG - Intronic
993500177 5:88658367-88658389 TGTAATATATACCTCTTGAGTGG - Intergenic
1000747937 5:165058468-165058490 AGGAAGCTAAATCTCATGAGAGG + Intergenic
1009335212 6:62479712-62479734 TGAAAGCTAGATATCATGATTGG - Intergenic
1010380822 6:75223026-75223048 TTTAAGCTACATCCCATGAGGGG - Intergenic
1011966912 6:93171244-93171266 TGCAAGTTAGATCACTTCAGTGG - Intergenic
1012852620 6:104465080-104465102 TGTGAGTTAGAGCTGTTGAGAGG - Intergenic
1013479536 6:110542221-110542243 TAAAAGCTAAACCTCTTGAGTGG + Intergenic
1020596818 7:10216925-10216947 TGTAAGCTGATTCTCTTGTGAGG - Intergenic
1023987650 7:45106230-45106252 TGCAAGCAAGAACTCTAGAGTGG + Intronic
1027716003 7:81670734-81670756 TGTGAGCTATAGCTCTTCAGTGG + Intergenic
1028130577 7:87167865-87167887 TCTAAGCTAGAATTTTTGAGTGG + Intronic
1029603073 7:101581308-101581330 TGTAAAATTGATCTCTTGGGCGG - Intergenic
1032626874 7:133600784-133600806 TGTAAGCTAGAACTCTGCACCGG - Intronic
1042573352 8:70191522-70191544 TGTAAGGTTCATCTCTTCAGAGG - Intronic
1046276142 8:111962990-111963012 TGTGAGATGGATCTCTTGAAGGG + Intergenic
1052150517 9:25109304-25109326 TGTATCCTAGATCTCCTAAGTGG + Intergenic
1052242896 9:26296388-26296410 TGTAATGAAGATCTTTTGAGGGG - Intergenic
1059358669 9:113721291-113721313 TGTATGATAGATCTCTTGAAAGG + Intergenic
1188029057 X:25244041-25244063 TGTAAGGTAGACATTTTGAGAGG - Intergenic
1189621447 X:42844703-42844725 TGGAAGCTAGAAGTCTTAAGTGG + Intergenic
1189702904 X:43730361-43730383 TGTTAAATAGTTCTCTTGAGCGG - Intronic