ID: 1115903731

View in Genome Browser
Species Human (GRCh38)
Location 14:38183936-38183958
Sequence TGTAAGCTAGATCTCTTGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 73}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115903726_1115903731 13 Left 1115903726 14:38183900-38183922 CCATGTGATTTAGAGAGGGGGTT 0: 1
1: 0
2: 1
3: 14
4: 128
Right 1115903731 14:38183936-38183958 TGTAAGCTAGATCTCTTGAGGGG 0: 1
1: 0
2: 1
3: 7
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115903731 Original CRISPR TGTAAGCTAGATCTCTTGAG GGG Intergenic