ID: 1115905910

View in Genome Browser
Species Human (GRCh38)
Location 14:38202711-38202733
Sequence CAGAACTACCAGGAGTGGTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115905910_1115905915 29 Left 1115905910 14:38202711-38202733 CCGGACCACTCCTGGTAGTTCTG No data
Right 1115905915 14:38202763-38202785 CCCCCCATTTTGCCTCCAGCAGG 0: 1
1: 0
2: 0
3: 8
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115905910 Original CRISPR CAGAACTACCAGGAGTGGTC CGG (reversed) Intergenic
No off target data available for this crispr