ID: 1115907192

View in Genome Browser
Species Human (GRCh38)
Location 14:38212529-38212551
Sequence CTACATTGGAAGCCTGAGCA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 244
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 230}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115907192 Original CRISPR CTACATTGGAAGCCTGAGCA GGG Exonic
900219444 1:1499703-1499725 CTACTTGGGAAGGCTGAGGAAGG - Intergenic
902040004 1:13485691-13485713 CTCCATTGGTGGCCTGAGCCTGG + Intronic
904914573 1:33960607-33960629 CTGCAGTGGAAGCCTGTGCCAGG + Intronic
906859977 1:49349091-49349113 CTAGACAGGAAGCATGAGCAAGG - Intronic
906939493 1:50243947-50243969 CTACACTGGAAGCTGCAGCAGGG + Intergenic
907204874 1:52760702-52760724 ATACTTTGGAAGCCTGAGGCAGG - Intronic
907538277 1:55185813-55185835 GAACTTTGGAAGCCTGAGCTGGG - Intronic
907961894 1:59291548-59291570 CTAGATTGGAAGCCTCTGGAGGG - Intergenic
908120084 1:60978157-60978179 CTACATTGTGAGTCTGAGAATGG - Intronic
909843365 1:80358370-80358392 TTACATTCCAAGGCTGAGCATGG + Intergenic
912352540 1:109027860-109027882 CTACTTTGGAAGGCTGAGGTGGG + Intronic
914885109 1:151578289-151578311 TTACATTGGAAGCATCATCAGGG - Intronic
915970663 1:160352898-160352920 CTACATTGGCAGCTCGAGGATGG + Exonic
917147840 1:171911731-171911753 CTTCATCTGAAGCCTTAGCAGGG + Intronic
917616939 1:176755503-176755525 CTACATTCATAGCCTGAGCTTGG - Intronic
917697687 1:177543684-177543706 ATACATCTGAAGACTGAGCATGG - Intergenic
917784442 1:178437706-178437728 CTACACGGGAAGCCTGATTAAGG - Intronic
917823816 1:178794931-178794953 GCACATTGGAAGGCTGAGCCAGG + Intronic
917986926 1:180330119-180330141 CTTCATTTGAAGGCTGGGCATGG + Intronic
918558057 1:185829223-185829245 ATACAATTGAAGCCTGGGCATGG + Intronic
918568445 1:185958224-185958246 CTACTTTGGAAGACTGAGGTGGG - Intronic
920700528 1:208215104-208215126 CTACTCTGGAGGCCTGAGCATGG - Intronic
1064989593 10:21244403-21244425 GTACCTTGGAAGCCTGAGGCAGG + Intergenic
1066654075 10:37683071-37683093 ACACAGTGGCAGCCTGAGCAGGG + Intergenic
1067019650 10:42783371-42783393 CGACATTGGAAGGCTGCACAGGG - Intronic
1068716252 10:60192136-60192158 CTACTTTGGAAGACTGAGACGGG - Intronic
1069530712 10:69217321-69217343 CTACATTCCAGGCCTGAGTAAGG - Intergenic
1070139670 10:73729903-73729925 CTACATTGCAAGGCTGCACAGGG + Intergenic
1070698014 10:78577434-78577456 CTGAGTTGGAAGCCTGGGCAAGG + Intergenic
1070783326 10:79149727-79149749 CTGCATTCGAAGCCTGAACTTGG + Intronic
1070886664 10:79905583-79905605 CTACATTGCAAGGCTGCACAGGG - Intergenic
1070995885 10:80780838-80780860 CTACATTGGGAGGCTGAGGTGGG + Intergenic
1071278719 10:84079896-84079918 CTACATAGGAAGCAGTAGCAGGG + Intergenic
1073263197 10:102206117-102206139 CTACTTGGGAAGCCTGAGGCAGG + Intergenic
1074534451 10:114318905-114318927 GTACTTTGGAAGGCTGAGGAGGG + Intronic
1074793370 10:116914953-116914975 CTATAATAGAAGCCTCAGCAAGG + Intronic
1078520202 11:12056884-12056906 TGACTTTGGAAGCCTGAACATGG + Intergenic
1079014482 11:16856950-16856972 CTGCTTTGGAGGCCTGGGCAAGG + Intronic
1079364632 11:19798612-19798634 CGACTTTGGAAGCCTGAGTTGGG + Intronic
1081188752 11:40078078-40078100 CTTCATTGGCAGCATGAGAACGG - Intergenic
1081460747 11:43270354-43270376 CTACTTGGGAGGCCTGAGCATGG + Intergenic
1083214473 11:61209893-61209915 CTACACTGGAAGTCTGAACTGGG + Exonic
1083217357 11:61228722-61228744 CTACACTGGAAGTCTGAACTGGG + Exonic
1083220348 11:61248470-61248492 CTACACTGGAAGTCTGAACTGGG + Exonic
1083352870 11:62043497-62043519 CTTCAGTGGAAGGCTGATCAAGG + Intergenic
1086791752 11:91048541-91048563 ATAAATTGGCAGCCTGAGCCAGG + Intergenic
1087966349 11:104421280-104421302 GTACTTTGGAAGGCTGAGGAAGG - Intergenic
1094187241 12:27657859-27657881 GTACTTTGGAAGGCTGAGGAAGG + Intronic
1094233736 12:28139083-28139105 CTACTTTGAAAGCCAGAACATGG + Intronic
1094542784 12:31376386-31376408 CTACTTTGGAAGGCCGAGCCGGG - Intergenic
1096078668 12:48819638-48819660 CTGCAGAGGAAGCCTCAGCAGGG - Intronic
1102867702 12:116387090-116387112 CTGCATTGGGAGCCTGGCCAAGG - Intergenic
1108228608 13:48316369-48316391 CTGCAGTGGTAGCCTGAGGAAGG - Intronic
1108990146 13:56645686-56645708 CTACATTGAAAGCCAAAGCAGGG - Intergenic
1109955669 13:69562623-69562645 CTGCATTGGGTGGCTGAGCACGG + Intergenic
1110135523 13:72062708-72062730 CGACCTGGGATGCCTGAGCATGG + Intergenic
1110238694 13:73243344-73243366 CTAGATTGTAAGGCTGAGGAGGG + Intergenic
1110316238 13:74110904-74110926 TTACATTGGAAGGCTGAGGTGGG + Intronic
1111377608 13:87401230-87401252 CTACTTGGGAAGCCTGAGGCAGG - Intergenic
1111999188 13:95194071-95194093 CTTCCTTGGAAGCATGAGGAGGG + Intronic
1112115373 13:96346461-96346483 CTACATTGGGAGGCTGAGGCAGG + Intronic
1112183112 13:97104479-97104501 CAAAATTTGAAGCCTGAGGAGGG - Intergenic
1113316258 13:109182526-109182548 CTTCATTGGAAGGCTAAGGAAGG - Intronic
1114315044 14:21502129-21502151 CTACAATTGAAGGCTGAGCTGGG - Intronic
1115261856 14:31462471-31462493 GCACATTGGAAGGCTGAGGAAGG + Intergenic
1115907192 14:38212529-38212551 CTACATTGGAAGCCTGAGCAGGG + Exonic
1118221751 14:63860879-63860901 CTGCAGTGGAAACATGAGCAGGG + Intronic
1118662836 14:68033641-68033663 CTACATAGAAAGCATGAGGAGGG + Intronic
1119344808 14:73914564-73914586 CGACATTGGAAGGCTGAGACAGG - Intronic
1120628518 14:86859456-86859478 CTACTTTGGGAGGCTGAGAAGGG - Intergenic
1122684009 14:103490025-103490047 CAACATTGGAAGGCTGGGCATGG + Intronic
1202929499 14_KI270725v1_random:25846-25868 TTGCATGGGAATCCTGAGCATGG + Intergenic
1123422799 15:20145377-20145399 TTGCATGGGAATCCTGAGCATGG - Intergenic
1123532024 15:21151917-21151939 TTGCATGGGAATCCTGAGCATGG - Intergenic
1125875041 15:43136701-43136723 CCACTTTAGAAGGCTGAGCAGGG - Intronic
1126497454 15:49307716-49307738 CTACTTTGGAAATCTGAGAAAGG + Intronic
1129341510 15:74889553-74889575 CCACAGCGGAAGCCAGAGCAAGG - Intergenic
1133431103 16:5737372-5737394 CTACTTTGGAAGGCTGAGGCAGG + Intergenic
1134403824 16:13937892-13937914 CTACATTGGAAACCTCTGGATGG + Intronic
1135741508 16:24979373-24979395 CTGCAATGGAATTCTGAGCAAGG - Intronic
1138459121 16:57137725-57137747 CTACTTTGGCAGCCTCAGCCGGG - Intronic
1140566532 16:76049191-76049213 CTGCATTGGATGCCCAAGCAAGG - Intergenic
1141115960 16:81309382-81309404 CTACTTGGGGAGCCTGAGGAAGG + Intergenic
1141235775 16:82214678-82214700 CTTCATTAGCAGCCTGAGAAGGG + Intergenic
1203147560 16_KI270728v1_random:1811121-1811143 TTGCGTTGGAATCCTGAGCATGG - Intergenic
1144427623 17:15158596-15158618 CTGCTTTGGAAGCCTGAGGCTGG - Intergenic
1145996345 17:29106954-29106976 CAAAACTGGGAGCCTGAGCAGGG + Intronic
1146168631 17:30614164-30614186 CTACATTGGGAGGCTGAGGTGGG + Intergenic
1146221607 17:31027655-31027677 CTACATTGGGAGGCTGAGGTGGG + Intergenic
1146340432 17:32014673-32014695 ATACATTGGAAGTCTCACCAGGG - Intronic
1146656149 17:34636364-34636386 CTACATGGGAGGTCAGAGCAAGG + Intronic
1147299888 17:39518087-39518109 CTACATTGGGAGGCTGAGGCAGG - Intronic
1148488738 17:48009403-48009425 CCACTTTGGAAGGCTGAGGAGGG - Intergenic
1149756104 17:59187325-59187347 CCACTTTGGAAGACTGAGGAGGG + Intronic
1150366232 17:64588241-64588263 CTACATTGGGAGGCTGAGGTGGG - Intronic
1151964200 17:77422739-77422761 CTACTTTGGAAGCAAGAGCCAGG - Intronic
1156488575 18:37482652-37482674 CTTCATTGGAGGCCTGAAAAGGG - Intronic
1157090226 18:44628023-44628045 CTACAGTGGATGTCTGGGCAGGG - Intergenic
1157327112 18:46677323-46677345 CTCCATTGGGTGCCTGACCAAGG + Intronic
1159140620 18:64389734-64389756 CTACCTTGGGAGGCTGAGGAAGG - Intergenic
1160004973 18:75062994-75063016 CTACAGTGCAAGCTTCAGCAGGG - Intronic
1162193114 19:8962652-8962674 CAACCTTGGAAACCTCAGCAGGG - Exonic
1163528460 19:17835486-17835508 GTTCATTGGAAGCTTGAGCAAGG - Intronic
1165448457 19:35869293-35869315 CTGCAACGGGAGCCTGAGCAAGG + Intronic
1167238061 19:48326820-48326842 CTGCAGTGGAAGCCTGGGGAGGG - Exonic
1167869099 19:52352695-52352717 CTGCACAGGATGCCTGAGCAGGG - Intronic
926167383 2:10530013-10530035 CTACTTTGGAAGGCTGAGGCAGG - Intergenic
928025146 2:27733468-27733490 CTTCATTAGAAGCATGAGAATGG - Intergenic
928154356 2:28862621-28862643 TTACATTAAAAGGCTGAGCATGG - Intronic
928174547 2:29024775-29024797 CTGCAGAGGCAGCCTGAGCATGG + Intronic
929599447 2:43195961-43195983 GCACTTTGGAAGCCTGAGGAGGG - Intergenic
929665196 2:43828387-43828409 ATACTTTGGAAGGCTGAGGAGGG + Intronic
931605741 2:64050423-64050445 CTACATTGGGAGGCTGAGGCAGG - Intergenic
934460392 2:94211406-94211428 TTGCATGGGAATCCTGAGCATGG + Intergenic
934516202 2:94988399-94988421 CCACAGTGGAAGCCTGAGAAGGG + Intergenic
935569000 2:104639357-104639379 GTAGTTTGTAAGCCTGAGCAAGG + Intergenic
936111716 2:109670671-109670693 TTCCATGGGAATCCTGAGCATGG + Intergenic
940924292 2:159346576-159346598 GTACTTTGGAAGCCTGAGGCAGG + Intronic
942986434 2:182148342-182148364 CTACTTTGGACTCCTAAGCATGG + Intronic
943596858 2:189868586-189868608 GTACATTGGAACCATGAGGAAGG + Intronic
944229238 2:197376552-197376574 GTACTTTGGGAGCCTGAGGAGGG + Intergenic
944559121 2:200917396-200917418 CTACTTTGGGAGCCTGAGGAGGG - Intronic
946548916 2:220778511-220778533 ATACATTGGCACCCTTAGCAGGG - Intergenic
946848169 2:223879546-223879568 CTACTTTGGAAGGCTGAGGTGGG + Intronic
947156845 2:227171357-227171379 CTACATTTATACCCTGAGCATGG - Intronic
947221321 2:227795232-227795254 GCACTTTGGAAGCCTGAGGAGGG - Intergenic
947648804 2:231766744-231766766 GTACTTTGGAAGGCTGAGAAGGG + Intronic
948087279 2:235262112-235262134 TTACAATGAATGCCTGAGCAGGG + Intergenic
948700435 2:239756412-239756434 CTCCCTGGGAGGCCTGAGCATGG + Intergenic
1168806822 20:676501-676523 CTCCAGTGGGAGCCCGAGCAGGG - Intergenic
1169985392 20:11437683-11437705 CTATTTTGGAAGCCTTTGCAGGG - Intergenic
1171245147 20:23604715-23604737 CAGCATTGGAATCCTGAGGATGG + Intronic
1172370792 20:34389262-34389284 GTACTTTGGAAGGCTGAGCAGGG - Intronic
1173175087 20:40758918-40758940 CTACAAGGGAAGGCTCAGCAGGG - Intergenic
1174543275 20:51306445-51306467 CTGCATTTGAAGCAGGAGCATGG + Intergenic
1175966780 20:62663944-62663966 TAGCATTGGAGGCCTGAGCAGGG - Intronic
1175983662 20:62753762-62753784 CTCCATTGGAAGCCGGGCCATGG + Intronic
1176591525 21:8654445-8654467 TTGCATGGGAATCCTGAGCATGG + Intergenic
1177188799 21:17826525-17826547 CCACTTTGGAAGCCTGAGGCAGG + Intergenic
1178681258 21:34673896-34673918 CTACAGTGGACACCTGAGCTGGG + Intronic
1180224892 21:46386470-46386492 CTCCATTGGGAGCCTGTGCCTGG + Intronic
1180274372 22:10631557-10631579 TTGCATGGGAATCCTGAGCATGG + Intergenic
1181481338 22:23201108-23201130 CTACATGGGCAGCCAGAGTAGGG - Intronic
1182161606 22:28127973-28127995 ATACTTTGGAAGCCTGAGGCAGG - Intronic
1182461867 22:30489144-30489166 CTCAACTGGAAGGCTGAGCATGG + Exonic
1183748839 22:39707644-39707666 CTGCAGGTGAAGCCTGAGCAGGG - Intergenic
1183988786 22:41584283-41584305 CTTCTTGGGCAGCCTGAGCAGGG + Exonic
950064594 3:10101753-10101775 CTACATTAGAATCCTGAGCCAGG - Intronic
950728663 3:14936959-14936981 CTACTTTGGAAGGCTGAGGTGGG - Intergenic
956838530 3:73115694-73115716 GTACTTTGGAAGGCTGAGGAGGG + Intergenic
957391081 3:79570330-79570352 CTCTCTTGGAAGCCTAAGCAGGG - Intronic
958640923 3:96803371-96803393 GCACTTTGGGAGCCTGAGCAGGG + Intergenic
959041018 3:101423737-101423759 GTACATGGTAAGCCTGTGCAAGG - Intronic
959315330 3:104798286-104798308 CTTCATCAGAATCCTGAGCATGG + Intergenic
962057003 3:131883198-131883220 CAACATTGGAAGCATGTTCATGG + Intronic
965705312 3:171500617-171500639 CTACATGGGCAGCCTGAGGCAGG - Intergenic
967307876 3:188076488-188076510 TTTCATAGGAAGCCTCAGCAGGG - Intergenic
969993317 4:11286968-11286990 CAACAAAGGAAGCCAGAGCAGGG - Intergenic
970581711 4:17479177-17479199 GCACATTGGAAGGCTGGGCATGG - Intronic
973903319 4:55500452-55500474 CTACATTGGGAGGCTGAGGCAGG - Intronic
974087747 4:57279238-57279260 CTACAGTGTAAGCCTAAGCTAGG + Intergenic
976391923 4:84514423-84514445 CTACTTTGGAAGGCTGAGGCAGG + Intergenic
976676366 4:87707938-87707960 ATACAGTGGAAGCCAGAACAGGG - Intergenic
976710957 4:88071294-88071316 GCACTTTGGGAGCCTGAGCAGGG - Intronic
977594095 4:98859261-98859283 CTACGTTGGGAGGCTGAGGAGGG + Intergenic
979676524 4:123415383-123415405 CTACTTGGGAAGGCTGAGGAAGG - Intergenic
986668198 5:10121146-10121168 ATACTCTGGAAGGCTGAGCAAGG + Intergenic
987651657 5:20749070-20749092 CCACATTGGAAGGCTGAGGCTGG - Intergenic
988537790 5:32084384-32084406 CTGCATTGGAAGGATGAGGACGG - Intronic
989817531 5:45754299-45754321 CTACATTGGGAGGCTGAGGTGGG - Intergenic
992053560 5:72964493-72964515 CTATATTGGGAGGCTGAGCCAGG - Intronic
992987978 5:82253268-82253290 CTACAATGGAAACGTTAGCATGG + Intronic
994175614 5:96707683-96707705 CCACGTTTGGAGCCTGAGCAAGG + Intronic
994733465 5:103522671-103522693 CCACCTTGAAAGCCAGAGCAGGG + Intergenic
997053974 5:130418258-130418280 CTTCATTGGAAGTCTTAACATGG + Intergenic
997881308 5:137593214-137593236 CAACAAGGGAAGCCTGAGCATGG + Intronic
999055700 5:148573761-148573783 CTACATTGTAAGGCTTTGCAGGG - Intronic
999089348 5:148921702-148921724 CTACCTTAGAAGCCTGGGCTAGG - Intergenic
1001015693 5:168139057-168139079 CTCCTTGGGAAGCTTGAGCAAGG - Intronic
1002401480 5:178993786-178993808 CTACATTTGAGGACAGAGCAGGG + Intronic
1004403631 6:15311464-15311486 CTACATGGGAAGGCTGAGGCAGG + Intronic
1006971040 6:38045333-38045355 CTACTTTGGAAGGCCGAGCTGGG - Intronic
1010022416 6:71175963-71175985 CTGCAGTGGAAGCATGAGAAGGG - Intergenic
1010247635 6:73676540-73676562 CAACCTTGGAATACTGAGCAAGG - Intergenic
1010411941 6:75570585-75570607 CTACATTGGGAGGCTGAGGCAGG - Intergenic
1010601097 6:77827247-77827269 CTACATTGGGAGGCTGAGGCAGG + Intronic
1012768935 6:103404670-103404692 CTACCTTGGAAGGCTGAGGTGGG - Intergenic
1013270764 6:108543686-108543708 GTACACTGGAAGCCTGAAGAAGG + Intergenic
1014444644 6:121513146-121513168 CTTCATTAGAAGCGTGAGAACGG + Intergenic
1017680838 6:156862356-156862378 CTACAGTGGAAGCCACAGGAAGG + Intronic
1018559168 6:165083638-165083660 ATACATTGGCAGCCAGAGCCAGG + Intergenic
1021308712 7:19064419-19064441 TTACATTGCAAGCTTGTGCAAGG - Intronic
1024069408 7:45773472-45773494 CAACATTGAAAAGCTGAGCAGGG - Intergenic
1025278066 7:57601935-57601957 GCACATTGGAAGGCTGAGGAGGG - Intergenic
1025613059 7:63095173-63095195 CTACTTTGGAAGGCTGAGGCAGG + Intergenic
1025729630 7:64098531-64098553 CCACTTTGGAAGCCTGAGGCAGG - Intronic
1026280031 7:68914154-68914176 CTACATTGGCAGCCTCTACACGG - Intergenic
1029024059 7:97395928-97395950 GTACTTTGGAAGGCTGAGGAGGG - Intergenic
1029556363 7:101272548-101272570 CTACTTGGGAAGCCTGAGGCAGG + Intergenic
1031168238 7:118257497-118257519 GTAGATTGGAAGACTCAGCATGG + Intergenic
1032435595 7:131897829-131897851 CTGCCTTGGAGTCCTGAGCAGGG - Intergenic
1033368218 7:140687331-140687353 GCACTTTGGAAGCCTGAGCGGGG + Intronic
1033493141 7:141864225-141864247 CTACATTGAAAGCTTGAGGGTGG - Intergenic
1033862479 7:145644781-145644803 CTGCAGTGGAAGTCTGAGCAAGG + Intergenic
1037026460 8:14044236-14044258 GTACATTGGGAGGCTGAGTAAGG - Intergenic
1037829980 8:22181799-22181821 GCACTTTGGAAGCCTGAGCCAGG - Intronic
1041195722 8:55399757-55399779 CTACATAGGAGGGCTGGGCAAGG + Intronic
1043523182 8:81068266-81068288 GCACATTGGAAGCCTGAAAATGG + Intronic
1044498965 8:92928690-92928712 GTAGATGGGAGGCCTGAGCAGGG + Intronic
1045051849 8:98334646-98334668 CTAAAATGCAAGCCTGAACATGG + Intergenic
1045286746 8:100798185-100798207 CTACTTTGGAAGGATGAGGAGGG - Intergenic
1046643583 8:116760019-116760041 TTAAATTGGCAGGCTGAGCATGG - Intronic
1047098487 8:121649934-121649956 CTACCATGGAAGCCATAGCAGGG + Intergenic
1047349619 8:124061367-124061389 CTACAATGGAAGAATGTGCATGG + Intronic
1047757806 8:127932018-127932040 CAACAGAGGAAGCCTGAGGATGG - Intergenic
1049980024 9:895429-895451 CCACTGAGGAAGCCTGAGCATGG - Intronic
1050722902 9:8611456-8611478 GCACTTTGGAAGCCTGAGGAAGG + Intronic
1053483895 9:38437552-38437574 CTACATTTGCAGCATGAGAAGGG + Intergenic
1053690891 9:40587103-40587125 TTGCATGGGAATCCTGAGCATGG + Intergenic
1054273912 9:63050388-63050410 TTGCATGGGAATCCTGAGCATGG - Intergenic
1054302150 9:63388074-63388096 TTGCATGGGAATCCTGAGCATGG + Intergenic
1054400928 9:64714580-64714602 TTGCATGGGAATCCTGAGCATGG + Intergenic
1054434534 9:65198894-65198916 TTGCATGGGAATCCTGAGCATGG + Intergenic
1054495856 9:65822787-65822809 TTGCATGGGAATCCTGAGCATGG - Intergenic
1056113056 9:83415193-83415215 CAACAATGGAAGCCCCAGCAAGG - Intronic
1056299463 9:85226724-85226746 GCACTTTGGAAGCCTGAGGAGGG - Intergenic
1056361460 9:85861727-85861749 CTACCTTAGAAGGCTGGGCACGG - Intergenic
1057430892 9:94992758-94992780 CTGCATTGCAGGCCTCAGCACGG - Intronic
1060683505 9:125586567-125586589 CTAGATTGGAAGTGTTAGCAGGG - Intronic
1062232317 9:135488533-135488555 CTGCAGTGGTAGCCTGAGGAAGG + Exonic
1203621550 Un_KI270749v1:133209-133231 TTGCATGGGAATCCTGAGCATGG + Intergenic
1192554496 X:72079120-72079142 CTACATTGGCAAAATGAGCATGG - Intergenic
1192581885 X:72290013-72290035 CTACATAGTAAGCCTGAGCATGG + Intronic
1192675707 X:73193681-73193703 CTACTTGGGAAGCCTGAAGAAGG + Intergenic
1192780330 X:74287543-74287565 CTTTATTGGAAGTCTGTGCATGG - Intergenic
1194660231 X:96623015-96623037 AAACACTAGAAGCCTGAGCACGG + Intergenic
1196734220 X:118970675-118970697 CTACATGGGAAGCCAGTACAAGG + Intergenic
1196843815 X:119882444-119882466 GTACATTGGGAGGCTGGGCACGG - Intergenic
1198160410 X:134002466-134002488 CTACATTGGGAGGCTGAGGCAGG + Intergenic
1198210707 X:134513056-134513078 GGACATTGGAAGCCTGTGCTGGG + Intronic
1198435354 X:136611673-136611695 CTATTTTGGAAGGCAGAGCATGG + Intergenic
1198836192 X:140807089-140807111 CTTTATTAGAAGCCTGAGAATGG - Intergenic
1199305334 X:146261010-146261032 ATACATTGAAAGCATGAGCATGG - Intergenic
1201973628 Y:19822183-19822205 TTACTTTGGAAGGCTGAGGAAGG + Intergenic