ID: 1115907284

View in Genome Browser
Species Human (GRCh38)
Location 14:38214004-38214026
Sequence CTCCTTCCAATGCATTAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115907281_1115907284 22 Left 1115907281 14:38213959-38213981 CCTATTTTGTCATTTGGTTTCAA No data
Right 1115907284 14:38214004-38214026 CTCCTTCCAATGCATTAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115907284 Original CRISPR CTCCTTCCAATGCATTAGCT GGG Intergenic
No off target data available for this crispr