ID: 1115908191

View in Genome Browser
Species Human (GRCh38)
Location 14:38224671-38224693
Sequence GATTCTGAAGCTCCACAAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115908191_1115908194 16 Left 1115908191 14:38224671-38224693 CCAATTTGTGGAGCTTCAGAATC No data
Right 1115908194 14:38224710-38224732 ACCATGATCCCAATCCCTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115908191 Original CRISPR GATTCTGAAGCTCCACAAAT TGG (reversed) Intergenic
No off target data available for this crispr