ID: 1115909671

View in Genome Browser
Species Human (GRCh38)
Location 14:38241530-38241552
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115909671_1115909674 17 Left 1115909671 14:38241530-38241552 CCGGCACCTCATTCAAAAGGCAG No data
Right 1115909674 14:38241570-38241592 CCTTTTACCTGCAGCTTCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115909671 Original CRISPR CTGCCTTTTGAATGAGGTGC CGG (reversed) Intergenic
No off target data available for this crispr