ID: 1115909674

View in Genome Browser
Species Human (GRCh38)
Location 14:38241570-38241592
Sequence CCTTTTACCTGCAGCTTCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115909668_1115909674 25 Left 1115909668 14:38241522-38241544 CCACAATCCCGGCACCTCATTCA No data
Right 1115909674 14:38241570-38241592 CCTTTTACCTGCAGCTTCAGAGG No data
1115909671_1115909674 17 Left 1115909671 14:38241530-38241552 CCGGCACCTCATTCAAAAGGCAG No data
Right 1115909674 14:38241570-38241592 CCTTTTACCTGCAGCTTCAGAGG No data
1115909666_1115909674 29 Left 1115909666 14:38241518-38241540 CCACCCACAATCCCGGCACCTCA No data
Right 1115909674 14:38241570-38241592 CCTTTTACCTGCAGCTTCAGAGG No data
1115909672_1115909674 11 Left 1115909672 14:38241536-38241558 CCTCATTCAAAAGGCAGTCTCAA No data
Right 1115909674 14:38241570-38241592 CCTTTTACCTGCAGCTTCAGAGG No data
1115909667_1115909674 26 Left 1115909667 14:38241521-38241543 CCCACAATCCCGGCACCTCATTC No data
Right 1115909674 14:38241570-38241592 CCTTTTACCTGCAGCTTCAGAGG No data
1115909670_1115909674 18 Left 1115909670 14:38241529-38241551 CCCGGCACCTCATTCAAAAGGCA No data
Right 1115909674 14:38241570-38241592 CCTTTTACCTGCAGCTTCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115909674 Original CRISPR CCTTTTACCTGCAGCTTCAG AGG Intergenic
No off target data available for this crispr