ID: 1115912466

View in Genome Browser
Species Human (GRCh38)
Location 14:38271536-38271558
Sequence AGAGAGACATAACCAGTCTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115912466_1115912467 -2 Left 1115912466 14:38271536-38271558 CCTTAGACTGGTTATGTCTCTCT No data
Right 1115912467 14:38271557-38271579 CTTCCATGTAAACACTTTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115912466 Original CRISPR AGAGAGACATAACCAGTCTA AGG (reversed) Intergenic