ID: 1115917837

View in Genome Browser
Species Human (GRCh38)
Location 14:38336896-38336918
Sequence AACACGGAGGAGGGTATAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115917837_1115917843 -9 Left 1115917837 14:38336896-38336918 CCCATTATACCCTCCTCCGTGTT No data
Right 1115917843 14:38336910-38336932 CTCCGTGTTGGAATTACTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115917837 Original CRISPR AACACGGAGGAGGGTATAAT GGG (reversed) Intergenic
No off target data available for this crispr