ID: 1115917843

View in Genome Browser
Species Human (GRCh38)
Location 14:38336910-38336932
Sequence CTCCGTGTTGGAATTACTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115917832_1115917843 18 Left 1115917832 14:38336869-38336891 CCCTGATGAGAAAGGGGAGCCAG No data
Right 1115917843 14:38336910-38336932 CTCCGTGTTGGAATTACTGATGG No data
1115917835_1115917843 -1 Left 1115917835 14:38336888-38336910 CCAGAGGCCCCATTATACCCTCC No data
Right 1115917843 14:38336910-38336932 CTCCGTGTTGGAATTACTGATGG No data
1115917837_1115917843 -9 Left 1115917837 14:38336896-38336918 CCCATTATACCCTCCTCCGTGTT No data
Right 1115917843 14:38336910-38336932 CTCCGTGTTGGAATTACTGATGG No data
1115917836_1115917843 -8 Left 1115917836 14:38336895-38336917 CCCCATTATACCCTCCTCCGTGT No data
Right 1115917843 14:38336910-38336932 CTCCGTGTTGGAATTACTGATGG No data
1115917838_1115917843 -10 Left 1115917838 14:38336897-38336919 CCATTATACCCTCCTCCGTGTTG No data
Right 1115917843 14:38336910-38336932 CTCCGTGTTGGAATTACTGATGG No data
1115917833_1115917843 17 Left 1115917833 14:38336870-38336892 CCTGATGAGAAAGGGGAGCCAGA No data
Right 1115917843 14:38336910-38336932 CTCCGTGTTGGAATTACTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115917843 Original CRISPR CTCCGTGTTGGAATTACTGA TGG Intergenic
No off target data available for this crispr