ID: 1115925555

View in Genome Browser
Species Human (GRCh38)
Location 14:38429451-38429473
Sequence CTTTACACCCTGAAAGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115925555_1115925563 25 Left 1115925555 14:38429451-38429473 CCTCCCACTTTCAGGGTGTAAAG No data
Right 1115925563 14:38429499-38429521 TTTTGCATTTGATTCACTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115925555 Original CRISPR CTTTACACCCTGAAAGTGGG AGG (reversed) Intergenic
No off target data available for this crispr