ID: 1115933947

View in Genome Browser
Species Human (GRCh38)
Location 14:38530363-38530385
Sequence CCCCCTGAGCACTTGTACTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115933943_1115933947 14 Left 1115933943 14:38530326-38530348 CCTCATAATAAGAGGAAGAAAAA No data
Right 1115933947 14:38530363-38530385 CCCCCTGAGCACTTGTACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115933947 Original CRISPR CCCCCTGAGCACTTGTACTG AGG Intergenic
No off target data available for this crispr