ID: 1115936336

View in Genome Browser
Species Human (GRCh38)
Location 14:38557382-38557404
Sequence TTCCTCCTAAATCACAGTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115936331_1115936336 -7 Left 1115936331 14:38557366-38557388 CCCCTCTTTGTCACCTTTCCTCC No data
Right 1115936336 14:38557382-38557404 TTCCTCCTAAATCACAGTGTGGG No data
1115936333_1115936336 -9 Left 1115936333 14:38557368-38557390 CCTCTTTGTCACCTTTCCTCCTA No data
Right 1115936336 14:38557382-38557404 TTCCTCCTAAATCACAGTGTGGG No data
1115936332_1115936336 -8 Left 1115936332 14:38557367-38557389 CCCTCTTTGTCACCTTTCCTCCT No data
Right 1115936336 14:38557382-38557404 TTCCTCCTAAATCACAGTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115936336 Original CRISPR TTCCTCCTAAATCACAGTGT GGG Intergenic
No off target data available for this crispr