ID: 1115939863

View in Genome Browser
Species Human (GRCh38)
Location 14:38596701-38596723
Sequence GTGAGTCACCACATCTGTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115939863_1115939865 0 Left 1115939863 14:38596701-38596723 CCTGGACAGATGTGGTGACTCAC No data
Right 1115939865 14:38596724-38596746 ACCTGTAACACCAGCCCTTTGGG No data
1115939863_1115939871 25 Left 1115939863 14:38596701-38596723 CCTGGACAGATGTGGTGACTCAC No data
Right 1115939871 14:38596749-38596771 ACTGAGGCCAGCGAATCACAAGG No data
1115939863_1115939864 -1 Left 1115939863 14:38596701-38596723 CCTGGACAGATGTGGTGACTCAC No data
Right 1115939864 14:38596723-38596745 CACCTGTAACACCAGCCCTTTGG No data
1115939863_1115939867 9 Left 1115939863 14:38596701-38596723 CCTGGACAGATGTGGTGACTCAC No data
Right 1115939867 14:38596733-38596755 ACCAGCCCTTTGGGAGACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115939863 Original CRISPR GTGAGTCACCACATCTGTCC AGG (reversed) Intergenic
No off target data available for this crispr