ID: 1115941751

View in Genome Browser
Species Human (GRCh38)
Location 14:38617964-38617986
Sequence CCTGCACCAAGTTCTTCATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115941751_1115941757 15 Left 1115941751 14:38617964-38617986 CCACATGAAGAACTTGGTGCAGG No data
Right 1115941757 14:38618002-38618024 CCATACCCAGATGTAACCGGAGG No data
1115941751_1115941760 22 Left 1115941751 14:38617964-38617986 CCACATGAAGAACTTGGTGCAGG No data
Right 1115941760 14:38618009-38618031 CAGATGTAACCGGAGGTATCTGG No data
1115941751_1115941755 12 Left 1115941751 14:38617964-38617986 CCACATGAAGAACTTGGTGCAGG No data
Right 1115941755 14:38617999-38618021 ATGCCATACCCAGATGTAACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115941751 Original CRISPR CCTGCACCAAGTTCTTCATG TGG (reversed) Intergenic
No off target data available for this crispr