ID: 1115941755

View in Genome Browser
Species Human (GRCh38)
Location 14:38617999-38618021
Sequence ATGCCATACCCAGATGTAAC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115941751_1115941755 12 Left 1115941751 14:38617964-38617986 CCACATGAAGAACTTGGTGCAGG No data
Right 1115941755 14:38617999-38618021 ATGCCATACCCAGATGTAACCGG No data
1115941749_1115941755 17 Left 1115941749 14:38617959-38617981 CCTTCCCACATGAAGAACTTGGT No data
Right 1115941755 14:38617999-38618021 ATGCCATACCCAGATGTAACCGG No data
1115941747_1115941755 18 Left 1115941747 14:38617958-38617980 CCCTTCCCACATGAAGAACTTGG No data
Right 1115941755 14:38617999-38618021 ATGCCATACCCAGATGTAACCGG No data
1115941750_1115941755 13 Left 1115941750 14:38617963-38617985 CCCACATGAAGAACTTGGTGCAG No data
Right 1115941755 14:38617999-38618021 ATGCCATACCCAGATGTAACCGG No data
1115941746_1115941755 23 Left 1115941746 14:38617953-38617975 CCACTCCCTTCCCACATGAAGAA No data
Right 1115941755 14:38617999-38618021 ATGCCATACCCAGATGTAACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115941755 Original CRISPR ATGCCATACCCAGATGTAAC CGG Intergenic
No off target data available for this crispr