ID: 1115941760

View in Genome Browser
Species Human (GRCh38)
Location 14:38618009-38618031
Sequence CAGATGTAACCGGAGGTATC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115941753_1115941760 -7 Left 1115941753 14:38617993-38618015 CCCTCTATGCCATACCCAGATGT No data
Right 1115941760 14:38618009-38618031 CAGATGTAACCGGAGGTATCTGG No data
1115941750_1115941760 23 Left 1115941750 14:38617963-38617985 CCCACATGAAGAACTTGGTGCAG No data
Right 1115941760 14:38618009-38618031 CAGATGTAACCGGAGGTATCTGG No data
1115941751_1115941760 22 Left 1115941751 14:38617964-38617986 CCACATGAAGAACTTGGTGCAGG No data
Right 1115941760 14:38618009-38618031 CAGATGTAACCGGAGGTATCTGG No data
1115941747_1115941760 28 Left 1115941747 14:38617958-38617980 CCCTTCCCACATGAAGAACTTGG No data
Right 1115941760 14:38618009-38618031 CAGATGTAACCGGAGGTATCTGG No data
1115941749_1115941760 27 Left 1115941749 14:38617959-38617981 CCTTCCCACATGAAGAACTTGGT No data
Right 1115941760 14:38618009-38618031 CAGATGTAACCGGAGGTATCTGG No data
1115941754_1115941760 -8 Left 1115941754 14:38617994-38618016 CCTCTATGCCATACCCAGATGTA No data
Right 1115941760 14:38618009-38618031 CAGATGTAACCGGAGGTATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115941760 Original CRISPR CAGATGTAACCGGAGGTATC TGG Intergenic
No off target data available for this crispr