ID: 1115947611

View in Genome Browser
Species Human (GRCh38)
Location 14:38679895-38679917
Sequence ATGAGTAGATAAAGAAAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115947611_1115947613 -5 Left 1115947611 14:38679895-38679917 CCATGTTTTCTTTATCTACTCAT No data
Right 1115947613 14:38679913-38679935 CTCATTGATCACTGGCAATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115947611 Original CRISPR ATGAGTAGATAAAGAAAACA TGG (reversed) Intergenic
No off target data available for this crispr