ID: 1115947613

View in Genome Browser
Species Human (GRCh38)
Location 14:38679913-38679935
Sequence CTCATTGATCACTGGCAATT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115947611_1115947613 -5 Left 1115947611 14:38679895-38679917 CCATGTTTTCTTTATCTACTCAT No data
Right 1115947613 14:38679913-38679935 CTCATTGATCACTGGCAATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115947613 Original CRISPR CTCATTGATCACTGGCAATT AGG Intergenic
No off target data available for this crispr