ID: 1115949789

View in Genome Browser
Species Human (GRCh38)
Location 14:38708121-38708143
Sequence CTCTTGGAGCAGTGGCACTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115949779_1115949789 15 Left 1115949779 14:38708083-38708105 CCTCCCTCTTCCTCTGCCTTTGG No data
Right 1115949789 14:38708121-38708143 CTCTTGGAGCAGTGGCACTAAGG No data
1115949781_1115949789 12 Left 1115949781 14:38708086-38708108 CCCTCTTCCTCTGCCTTTGGACT No data
Right 1115949789 14:38708121-38708143 CTCTTGGAGCAGTGGCACTAAGG No data
1115949782_1115949789 11 Left 1115949782 14:38708087-38708109 CCTCTTCCTCTGCCTTTGGACTT No data
Right 1115949789 14:38708121-38708143 CTCTTGGAGCAGTGGCACTAAGG No data
1115949778_1115949789 16 Left 1115949778 14:38708082-38708104 CCCTCCCTCTTCCTCTGCCTTTG No data
Right 1115949789 14:38708121-38708143 CTCTTGGAGCAGTGGCACTAAGG No data
1115949777_1115949789 17 Left 1115949777 14:38708081-38708103 CCCCTCCCTCTTCCTCTGCCTTT No data
Right 1115949789 14:38708121-38708143 CTCTTGGAGCAGTGGCACTAAGG No data
1115949786_1115949789 -1 Left 1115949786 14:38708099-38708121 CCTTTGGACTTGGTGGAACAGTC No data
Right 1115949789 14:38708121-38708143 CTCTTGGAGCAGTGGCACTAAGG No data
1115949774_1115949789 29 Left 1115949774 14:38708069-38708091 CCCAGCTTCCATCCCCTCCCTCT No data
Right 1115949789 14:38708121-38708143 CTCTTGGAGCAGTGGCACTAAGG No data
1115949785_1115949789 5 Left 1115949785 14:38708093-38708115 CCTCTGCCTTTGGACTTGGTGGA No data
Right 1115949789 14:38708121-38708143 CTCTTGGAGCAGTGGCACTAAGG No data
1115949775_1115949789 28 Left 1115949775 14:38708070-38708092 CCAGCTTCCATCCCCTCCCTCTT No data
Right 1115949789 14:38708121-38708143 CTCTTGGAGCAGTGGCACTAAGG No data
1115949776_1115949789 21 Left 1115949776 14:38708077-38708099 CCATCCCCTCCCTCTTCCTCTGC No data
Right 1115949789 14:38708121-38708143 CTCTTGGAGCAGTGGCACTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115949789 Original CRISPR CTCTTGGAGCAGTGGCACTA AGG Intergenic
No off target data available for this crispr