ID: 1115951587

View in Genome Browser
Species Human (GRCh38)
Location 14:38727817-38727839
Sequence TGAGGTCAAGGCTTAGTACG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 1, 2: 8, 3: 22, 4: 151}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115951581_1115951587 0 Left 1115951581 14:38727794-38727816 CCCCGGACATGGACAGCCATCGC 0: 1
1: 0
2: 0
3: 3
4: 47
Right 1115951587 14:38727817-38727839 TGAGGTCAAGGCTTAGTACGAGG 0: 1
1: 1
2: 8
3: 22
4: 151
1115951583_1115951587 -2 Left 1115951583 14:38727796-38727818 CCGGACATGGACAGCCATCGCTG 0: 1
1: 0
2: 0
3: 5
4: 65
Right 1115951587 14:38727817-38727839 TGAGGTCAAGGCTTAGTACGAGG 0: 1
1: 1
2: 8
3: 22
4: 151
1115951578_1115951587 18 Left 1115951578 14:38727776-38727798 CCATGGACAACAGCTGTTCCCCG 0: 1
1: 0
2: 9
3: 14
4: 123
Right 1115951587 14:38727817-38727839 TGAGGTCAAGGCTTAGTACGAGG 0: 1
1: 1
2: 8
3: 22
4: 151
1115951582_1115951587 -1 Left 1115951582 14:38727795-38727817 CCCGGACATGGACAGCCATCGCT 0: 1
1: 0
2: 0
3: 6
4: 89
Right 1115951587 14:38727817-38727839 TGAGGTCAAGGCTTAGTACGAGG 0: 1
1: 1
2: 8
3: 22
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115951587 Original CRISPR TGAGGTCAAGGCTTAGTACG AGG Intergenic
902049475 1:13550809-13550831 AGAGCTCAAGGCTTAGTGTGCGG - Intergenic
903988493 1:27247423-27247445 TGAGTACTAGGCTTAGTACCTGG - Intronic
909232245 1:73105615-73105637 TGAAGTCAAGGGGCAGTACGAGG + Intergenic
915619771 1:157074036-157074058 TGAGGTCAAGGCACAGTACGAGG + Intergenic
920816374 1:209336979-209337001 TGAGTACTAGGCTTAGTACCTGG + Intergenic
923230863 1:231984885-231984907 TGAGGAAAAAGCTTAGCACGGGG + Intronic
1062944040 10:1446522-1446544 TGAGGTCAGGGCTTAGGCGGGGG + Intronic
1063776334 10:9269216-9269238 TGGGTACTAGGCTTAGTACGTGG + Intergenic
1064018118 10:11788261-11788283 AGAGACCAAGGCTTAGTACCAGG + Intergenic
1064153318 10:12883657-12883679 TGGGTACAAGGCTTAGTACCTGG - Intergenic
1064699498 10:18004494-18004516 TGAAGTTAAGTCTTAGTAAGGGG + Intronic
1064843072 10:19617925-19617947 TGAGTACTAGGCTTAGTACCTGG - Intronic
1064889113 10:20149175-20149197 TGAATCCAAGGCTTAGTACCTGG - Intronic
1065760525 10:28977928-28977950 TGAGTACAAGGCTTAATACCTGG + Intergenic
1068163237 10:53295216-53295238 TGAGTTCTAGGCTTAGTACCTGG + Intergenic
1069827613 10:71263667-71263689 TGATGTAAAGGTTTAGTAGGTGG - Intronic
1072368241 10:94736770-94736792 TGAGTACTAGGCTTAGTACCTGG - Intronic
1077730372 11:4723380-4723402 TGAGGTCAAGGCGCAGTACAAGG - Intronic
1078191495 11:9095265-9095287 TGAGGTCAAGGCGCAGTACAAGG + Intronic
1078679256 11:13460400-13460422 AGAGGTCAAAGCTAAGTAAGAGG - Intronic
1079098723 11:17527450-17527472 TGAGATCAAGGCTTATTCCAGGG - Intronic
1079803672 11:24902259-24902281 TGGGTACAAGGCTTAGTACCTGG - Intronic
1083077837 11:60059490-60059512 TGAGTACTAGGCTTAGTACCTGG - Intronic
1083671843 11:64304331-64304353 TGAGGTCAAGGCTAGGGAAGAGG - Intronic
1083913913 11:65727742-65727764 GGAGGTCAACGCCCAGTACGAGG + Intergenic
1089599268 11:119603501-119603523 TGAGGTCAAGGTGCAGTACGAGG - Intergenic
1089734826 11:120543156-120543178 TGAGTACTAGGCTTAGTACCTGG + Intronic
1092342095 12:7685508-7685530 TGAGTACTAGGCTTAGTACCTGG - Intergenic
1096530778 12:52241564-52241586 TGAGGTCAAGGCGCAGTATGAGG + Exonic
1096552390 12:52381411-52381433 TGAGGTCAAGGCCCAGTATGAGG - Exonic
1096562871 12:52449519-52449541 TGAGGTCAAGGCCCAATATGAGG - Exonic
1096565022 12:52471182-52471204 TGAGGTCAAGGCCCAATACGAGG - Exonic
1096567034 12:52490619-52490641 TGAGGTCAAGGCCCAATATGAGG - Exonic
1096570077 12:52517640-52517662 TGAGGTCAAGGCCCAGTATGAGG - Exonic
1096589497 12:52648223-52648245 CGAGGTCAAGGCCCAGTATGAGG - Exonic
1096593383 12:52677366-52677388 TGAGGTCAAGGCCCAGTACGAGG - Exonic
1096601014 12:52729525-52729547 TGAGGTCCACGCCCAGTACGAGG - Intergenic
1096603600 12:52748212-52748234 CAAGGTCAAGGCCTAGTATGAGG - Intergenic
1096626650 12:52899951-52899973 TGAGGTCAAGGCACAGTACGAGG - Exonic
1096980815 12:55727572-55727594 TGAGGTCAAGGCTTTCTGGGAGG - Intronic
1097615528 12:61880105-61880127 TGAGGTCAAGGCCCAGTATAAGG + Intronic
1097661902 12:62439440-62439462 TGAGTACAAGGCTTAATACCTGG - Intergenic
1098264665 12:68706417-68706439 TGAGGTCAAGGCACCGTACGAGG + Intronic
1098872178 12:75828837-75828859 TGAGTACTAGGCTTAGTACCTGG - Intergenic
1100039772 12:90301321-90301343 TGAGTACTAGGCTTAATACGTGG - Intergenic
1107330092 13:39290239-39290261 TGAGTACTAGGCTTAGTACCTGG + Intergenic
1110460822 13:75743743-75743765 TGAGTGCTAGGCTTAGTACCTGG + Intronic
1112227394 13:97553231-97553253 TGAGTACTAGGCTTAGTACCTGG - Intergenic
1113390271 13:109889821-109889843 TGAGTACTAGGCTTAGTACCTGG + Intergenic
1113493587 13:110712186-110712208 TGGGGACAGGGCTTAGTTCGTGG + Intronic
1114735409 14:25038706-25038728 TGGGCACTAGGCTTAGTACGTGG + Intronic
1114766855 14:25382546-25382568 TAAGGTCAAGGCTTAGATCTGGG + Intergenic
1115858602 14:37658869-37658891 TGAGTACTAGGCTTAGTACCTGG - Intronic
1115951587 14:38727817-38727839 TGAGGTCAAGGCTTAGTACGAGG + Intergenic
1122380160 14:101297474-101297496 TGGGTACTAGGCTTAGTACGTGG + Intergenic
1124073555 15:26419869-26419891 TGAGTACTAGGCTTAGTACCTGG + Intergenic
1124839892 15:33231709-33231731 TGAGGTCAACAATTAGTACAAGG + Intergenic
1125841066 15:42801609-42801631 TGAGGTCAAGGTGCAGTACGAGG - Intronic
1126467280 15:48972678-48972700 GGAGGTCAAGGCGCAGTACTAGG + Intergenic
1126659309 15:51016497-51016519 TGAGTACTAGGCTTAGTACCTGG + Intergenic
1127638238 15:60891438-60891460 TCAGGTCAAGGCTCAGCACCTGG + Intronic
1127845900 15:62870654-62870676 TGGGTACAAGGCTTAGTACCTGG - Intergenic
1128842202 15:70859495-70859517 TGAGGTCAAGGTGCAGTAGGAGG + Intronic
1129597965 15:76979647-76979669 TGAGGTCAAGGCACAGTATGAGG - Intergenic
1131314805 15:91325957-91325979 TGAGAACTAGGCTTAGTACTTGG - Intergenic
1136084124 16:27872397-27872419 TGAGGCACAGGCTTAGTAAGTGG - Intronic
1139294815 16:65891334-65891356 TGGGTTCTAGGCTTAGTACCTGG - Intergenic
1140753763 16:78049094-78049116 TGAGGTCAGGGCGCAGTATGAGG - Intronic
1141004215 16:80337069-80337091 TGGGGTCAAGGCAGAGTAGGTGG + Intergenic
1145894948 17:28450668-28450690 TGGGTACAAGGCTTAGTACCTGG - Intergenic
1147588978 17:41669087-41669109 GGAGGTCAAGGCTGGGCACGGGG + Intergenic
1150782291 17:68133773-68133795 TGAGGGCAAGGCTTGGGAGGCGG + Intergenic
1151143921 17:72021108-72021130 TGAGTACTAGGCTTAGTACCTGG - Intergenic
1156150762 18:34240180-34240202 TGAGTACAAGGCTTAATACATGG - Intergenic
1157063594 18:44321432-44321454 TGAGGTCAAGGCACAGTACAAGG - Intergenic
1158057016 18:53293568-53293590 TGAGTACTAGGCTTAGTACCTGG - Intronic
1158845599 18:61439144-61439166 TGAGTACTAGGCTTAGTACCTGG + Intronic
926877533 2:17498840-17498862 TGGGTACAAGGCTTAGTACCTGG - Intergenic
930331244 2:49987334-49987356 GGAGGCCAAGGCTTAGGACAGGG - Intronic
934880222 2:97970583-97970605 TGAGGTCAAGGCTTTGCAAATGG - Intronic
936792865 2:116170560-116170582 TGAGTTCTAGGCTTAATACCTGG - Intergenic
937441947 2:121923219-121923241 TGAGTACTAGGCTTAGTACCTGG - Intergenic
941250498 2:163155799-163155821 TGAGGTCAAGGCTTTCTGCAAGG + Intergenic
944752324 2:202722717-202722739 TGAGTACTAGGCTTAGTACCTGG + Intronic
944763484 2:202840976-202840998 TGAGGTCAAGGCGCAGTATGAGG - Intronic
1172859309 20:38034588-38034610 TGAAGTAAAGGCTTTGTAAGGGG - Intronic
1174730503 20:52911936-52911958 TGAGGTGAATGCTTTGTACTTGG - Intergenic
1176865628 21:14052910-14052932 TGAGTACAAGGCTTAATACGTGG - Intergenic
1179903845 21:44409953-44409975 TGAGGTCAAAACTTACTACAAGG - Intronic
1179903849 21:44409994-44410016 TGAGGTCAAAACTTACTACAAGG - Intronic
1179903897 21:44410630-44410652 TGAGGTCAAAACTTACTACAAGG - Intronic
1179903916 21:44410917-44410939 TGAGGTCAAAACTTACTACAAGG - Intronic
1180139910 21:45886902-45886924 GGAGGTCTAGGCTCTGTACGCGG + Intronic
1183213036 22:36462607-36462629 TGAGGTCACGGCTCAGCAGGTGG - Intergenic
1185281668 22:49972388-49972410 GGAGGTCAGGGCTTTGTAGGGGG - Intergenic
950034680 3:9876988-9877010 GGAGGTCAGGGCTTAGAAGGTGG - Intronic
952611584 3:35216349-35216371 TGAGATCAAGGCGCAGTAGGAGG - Intergenic
952808806 3:37383176-37383198 TGAGTACTAGGCTTAGTACCTGG - Intergenic
954581278 3:51704150-51704172 TGAGGAGAAGGCTTAGCAAGAGG - Exonic
955839520 3:63097005-63097027 TGAGGTCAAGGCACAGTAGGAGG - Intergenic
962553442 3:136521380-136521402 TGAGGTCCAGGCATGGTAAGAGG + Exonic
962712847 3:138102112-138102134 TGAGGTCAAGGCACAGTACAAGG - Intronic
964514690 3:157495020-157495042 GGAAGTCATGGCTTAGTAGGGGG - Intronic
965415878 3:168391466-168391488 TGAGTACAAGGCTTAATACCTGG + Intergenic
965605734 3:170496214-170496236 TGAGGTCAAGGCACAGTAGGAGG + Intronic
966113206 3:176428653-176428675 TGAGTTCAAAGCTTAGGAAGAGG - Intergenic
969703474 4:8780201-8780223 TGGGGTCGAGGCTTGGTTCGGGG + Intergenic
970039764 4:11782744-11782766 TGGGTACTAGGCTTAGTACGTGG + Intergenic
970672759 4:18415302-18415324 TGAGGTCAAGACTTTGTTCCAGG - Intergenic
972970390 4:44567492-44567514 TGAGTACTAGGCTTAGTACCTGG + Intergenic
973694174 4:53473698-53473720 TGAGTACTAGGCTTAGTACCTGG + Intronic
976511943 4:85921427-85921449 TGAGTACTAGGCTTAGTACCTGG + Intronic
977928710 4:102729368-102729390 TGAGGTCAAGGCACCATACGAGG - Intronic
980118383 4:128703449-128703471 TGAGTACTAGGCTTAGTACCTGG - Intergenic
981734903 4:147938257-147938279 TGAGTACTAGGCTTAGTACCTGG + Intronic
983080172 4:163375518-163375540 TGAGTACTAGGCTTAGTACCTGG - Intergenic
983153003 4:164308849-164308871 TGAGTACAAGGCTTAGTGCCTGG + Intronic
984346267 4:178531406-178531428 TGAGGTCAAAGATTACTAAGGGG + Intergenic
986918590 5:12658015-12658037 TGGGTACTAGGCTTAGTACGAGG - Intergenic
987331596 5:16862089-16862111 GGAGGTCATGGCTTAGAACTGGG + Intronic
988340854 5:29969202-29969224 TGAGTGCTAGGCTTAGTACTTGG + Intergenic
989352352 5:40500611-40500633 TGAGCTCAAAGATTAGAACGTGG - Intergenic
990360297 5:55012367-55012389 TGAGTTCTAGGCTTAATACCTGG + Intronic
990900531 5:60744202-60744224 TGAGGTCAAGGCGCAGTACTAGG - Intergenic
991134120 5:63161190-63161212 GGAGGACTAGGCTTAGTACCGGG + Intergenic
993015461 5:82530659-82530681 TGAGATCAAGGCTCATTACCAGG - Intergenic
993359758 5:86959718-86959740 TGAGTTCTAGGCTTAATACCTGG - Intergenic
994320838 5:98392723-98392745 TGAGGTAAAGGCGCAGTAGGAGG - Intergenic
995365783 5:111358666-111358688 TGAGTACTAGGCTTAGTACCTGG - Intronic
995961275 5:117842740-117842762 TGGGTACAAGGCTTAGTACCTGG + Intergenic
996432950 5:123401538-123401560 TGAGGTCAAGGCACAGTACGAGG - Intronic
996990807 5:129628348-129628370 TGAGTACTAGGCTTAGTACGTGG + Intronic
998887209 5:146706812-146706834 TGAGGTCAAGGTACAGTACGAGG - Intronic
999771082 5:154775965-154775987 TGAGGTAAATGCCTAGTAAGTGG + Intronic
1004059376 6:12177209-12177231 TGAGTACTAGGCTTAGTACCTGG + Intergenic
1005315462 6:24599135-24599157 TGAGGTCAAGGCCCAGTACAAGG + Intronic
1005439178 6:25847019-25847041 TGGGGACTAGGCTTAGTACCTGG - Intronic
1007179817 6:39921876-39921898 TGAGTACTAGGCTTAGTACCTGG - Intronic
1015539272 6:134297919-134297941 TGAGGTCAAGGCGCAGTACGAGG - Intronic
1016026695 6:139294602-139294624 TGAGAAGAAGGCTTTGTACGAGG + Intergenic
1018317228 6:162569092-162569114 TGAGGTCAAGGCGTAGTATGAGG + Intronic
1020499795 7:8903265-8903287 TGAGGACAAGGATTAATAAGAGG - Intergenic
1023289613 7:38655976-38655998 TGAGGTCAAGGCTCAGTACAAGG + Intergenic
1024324218 7:48096064-48096086 TGAGGTTGAGGCCTAGTAGGAGG + Intronic
1024923260 7:54583805-54583827 TGAGGTCAAGGATTTGGACAGGG + Intergenic
1025044888 7:55684199-55684221 AGAGGTCAAGACTTAGCCCGGGG + Intergenic
1025873909 7:65462165-65462187 TGAGGTCAAAGCATAGTCCCTGG + Intergenic
1028330181 7:89580480-89580502 TGAGTACTAGGCTTAGTACCTGG + Intergenic
1028390912 7:90315647-90315669 TGAGTACTAGGCTTAGTACCGGG + Intergenic
1028528387 7:91810795-91810817 TGAGTACTAGGCTTAGTACCTGG + Intronic
1028858446 7:95618881-95618903 TGGGTGCAAGGCTTAATACGTGG + Intergenic
1033511405 7:142063583-142063605 GGAGGCCAAGGCTTCTTACGTGG - Exonic
1034691363 7:153016862-153016884 TCAGGTCAAAGCTTATTAAGTGG - Intergenic
1038899205 8:31823233-31823255 TTAGGTCAAGGATCAGTATGGGG - Intronic
1040822130 8:51573341-51573363 GGAGGTCAAGGCTTTCTATGTGG - Intronic
1040935640 8:52779005-52779027 TGAGCACTAGGCTTAGTACCTGG - Intergenic
1041356994 8:57011989-57012011 TGAGTACTAGGCTTAGTACCTGG - Intergenic
1041781106 8:61579002-61579024 TGAGGTCAAGGCACAGTACGAGG + Intronic
1044199251 8:89414253-89414275 TGAGGTCAAGACCCAGTATGAGG - Intergenic
1046239521 8:111472375-111472397 TGGGTTCTAGGCTTAGTACCCGG + Intergenic
1047000883 8:120571146-120571168 TGAGAACAAGGCTATGTACGAGG + Intronic
1050500441 9:6292951-6292973 TCAGATAAAGGCTTAGTTCGTGG + Intergenic
1050690258 9:8219688-8219710 TGAATTCAAGGTTTAGTATGTGG + Intergenic
1051298508 9:15622176-15622198 TGGGTTCTAGGCTTAGTACCTGG + Intronic
1051318975 9:15879011-15879033 TGAGAACTAGGCTTAGTACCTGG + Intronic
1051818110 9:21133469-21133491 TGAGGTCAAGCCTTAGAGTGAGG + Intergenic
1057943611 9:99305942-99305964 TGAGGTCAAGGTGCAGTATGAGG + Intergenic
1060103275 9:120857973-120857995 TGAGGGCAAGGTTCAGTACCTGG - Exonic
1203775056 EBV:68285-68307 TGTGGCCAAGGCTCAGGACGTGG + Intergenic
1186330254 X:8524971-8524993 TGAGTACTAGGCTTAGTACCTGG - Intergenic
1187370859 X:18704858-18704880 TGAGGTGCAGGCTGAGTACTGGG + Intronic
1188728716 X:33618630-33618652 TGAGGTCAAAGCTTAGTCTTTGG + Intergenic
1190902339 X:54689074-54689096 TGAGTGCTAGGCTTAGTACCTGG + Intergenic
1190924772 X:54893402-54893424 TGGGTTCTAGGCTTAGTACCTGG + Intergenic
1191012865 X:55778845-55778867 TGAGTACTAGGCTTAGTACCTGG - Intergenic
1191220728 X:57985465-57985487 TGAGGTCAAGGTGCAGTACGAGG + Intergenic
1192722166 X:73710595-73710617 TGAGTACTAGGCTTAGTACCTGG + Intergenic
1194268158 X:91779732-91779754 TGAGGTCCACACTTAGTGCGCGG + Intronic
1195377291 X:104240152-104240174 AGAGGTCAATGCTTAGTGTGGGG + Intergenic
1196107508 X:111912464-111912486 TGAGTTCAAGGCCGAGTATGAGG - Exonic
1199927225 X:152480355-152480377 TGAGGTCAAGGCGTAGTACGAGG + Intergenic
1200585359 Y:5000653-5000675 TGAGGTCCACACTTAGTGCGCGG + Intronic
1201587221 Y:15574214-15574236 TGAGGACTAGGCTTAATACCTGG + Intergenic