ID: 1115951625

View in Genome Browser
Species Human (GRCh38)
Location 14:38728077-38728099
Sequence CAGCTCGGACAGCTTGGTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115951625_1115951631 5 Left 1115951625 14:38728077-38728099 CCAACACCAAGCTGTCCGAGCTG No data
Right 1115951631 14:38728105-38728127 TACCCTATAGCAAGCCAAGCAGG 0: 1
1: 0
2: 0
3: 3
4: 52
1115951625_1115951634 11 Left 1115951625 14:38728077-38728099 CCAACACCAAGCTGTCCGAGCTG No data
Right 1115951634 14:38728111-38728133 ATAGCAAGCCAAGCAGGACTTGG 0: 1
1: 0
2: 1
3: 13
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115951625 Original CRISPR CAGCTCGGACAGCTTGGTGT TGG (reversed) Intergenic
No off target data available for this crispr