ID: 1115954446

View in Genome Browser
Species Human (GRCh38)
Location 14:38762484-38762506
Sequence TCCAAATCCAAACGATTATA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115954442_1115954446 17 Left 1115954442 14:38762444-38762466 CCATCTGCAAGAAAGGCCTGTAA No data
Right 1115954446 14:38762484-38762506 TCCAAATCCAAACGATTATACGG No data
1115954440_1115954446 24 Left 1115954440 14:38762437-38762459 CCATGCACCATCTGCAAGAAAGG No data
Right 1115954446 14:38762484-38762506 TCCAAATCCAAACGATTATACGG No data
1115954443_1115954446 1 Left 1115954443 14:38762460-38762482 CCTGTAAATAATCCTTCTTTTCC No data
Right 1115954446 14:38762484-38762506 TCCAAATCCAAACGATTATACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115954446 Original CRISPR TCCAAATCCAAACGATTATA CGG Intergenic
No off target data available for this crispr