ID: 1115954527

View in Genome Browser
Species Human (GRCh38)
Location 14:38763507-38763529
Sequence AGGAGCACAAAGTTAAAGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115954527_1115954533 22 Left 1115954527 14:38763507-38763529 CCTAGCTTTAACTTTGTGCTCCT No data
Right 1115954533 14:38763552-38763574 TCTTCAGTAACTCACACCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115954527 Original CRISPR AGGAGCACAAAGTTAAAGCT AGG (reversed) Intergenic
No off target data available for this crispr