ID: 1115955788

View in Genome Browser
Species Human (GRCh38)
Location 14:38777573-38777595
Sequence GCTCCTAACAGGCCACAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115955781_1115955788 7 Left 1115955781 14:38777543-38777565 CCTGCTGCTCACCTCCTGCTGTG 0: 291
1: 685
2: 1063
3: 1112
4: 1221
Right 1115955788 14:38777573-38777595 GCTCCTAACAGGCCACAAACTGG No data
1115955784_1115955788 -4 Left 1115955784 14:38777554-38777576 CCTCCTGCTGTGTGGCCTGGCTC 0: 5
1: 188
2: 493
3: 950
4: 1493
Right 1115955788 14:38777573-38777595 GCTCCTAACAGGCCACAAACTGG No data
1115955785_1115955788 -7 Left 1115955785 14:38777557-38777579 CCTGCTGTGTGGCCTGGCTCCTA 0: 6
1: 186
2: 499
3: 975
4: 1384
Right 1115955788 14:38777573-38777595 GCTCCTAACAGGCCACAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115955788 Original CRISPR GCTCCTAACAGGCCACAAAC TGG Intergenic
No off target data available for this crispr