ID: 1115956996

View in Genome Browser
Species Human (GRCh38)
Location 14:38792372-38792394
Sequence TCCACAGGGCAACCCCAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115956990_1115956996 1 Left 1115956990 14:38792348-38792370 CCCTAAGCACAAGGCTTGCCAGC No data
Right 1115956996 14:38792372-38792394 TCCACAGGGCAACCCCAAGGAGG No data
1115956986_1115956996 24 Left 1115956986 14:38792325-38792347 CCACACTCCAGCCAAGGAGAGCA No data
Right 1115956996 14:38792372-38792394 TCCACAGGGCAACCCCAAGGAGG No data
1115956988_1115956996 13 Left 1115956988 14:38792336-38792358 CCAAGGAGAGCACCCTAAGCACA No data
Right 1115956996 14:38792372-38792394 TCCACAGGGCAACCCCAAGGAGG No data
1115956991_1115956996 0 Left 1115956991 14:38792349-38792371 CCTAAGCACAAGGCTTGCCAGCT No data
Right 1115956996 14:38792372-38792394 TCCACAGGGCAACCCCAAGGAGG No data
1115956984_1115956996 30 Left 1115956984 14:38792319-38792341 CCTGGGCCACACTCCAGCCAAGG No data
Right 1115956996 14:38792372-38792394 TCCACAGGGCAACCCCAAGGAGG No data
1115956987_1115956996 17 Left 1115956987 14:38792332-38792354 CCAGCCAAGGAGAGCACCCTAAG No data
Right 1115956996 14:38792372-38792394 TCCACAGGGCAACCCCAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115956996 Original CRISPR TCCACAGGGCAACCCCAAGG AGG Intergenic
No off target data available for this crispr