ID: 1115957736

View in Genome Browser
Species Human (GRCh38)
Location 14:38799664-38799686
Sequence GCAACCTTTTTAGTTTGTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115957736_1115957741 9 Left 1115957736 14:38799664-38799686 CCCCAACAAACTAAAAAGGTTGC No data
Right 1115957741 14:38799696-38799718 CTGACCATTGACTTTGGCTTCGG No data
1115957736_1115957745 30 Left 1115957736 14:38799664-38799686 CCCCAACAAACTAAAAAGGTTGC No data
Right 1115957745 14:38799717-38799739 GGATTAGCATAAAGGTGTGTGGG No data
1115957736_1115957739 3 Left 1115957736 14:38799664-38799686 CCCCAACAAACTAAAAAGGTTGC No data
Right 1115957739 14:38799690-38799712 TCCTTGCTGACCATTGACTTTGG No data
1115957736_1115957744 29 Left 1115957736 14:38799664-38799686 CCCCAACAAACTAAAAAGGTTGC No data
Right 1115957744 14:38799716-38799738 CGGATTAGCATAAAGGTGTGTGG No data
1115957736_1115957743 22 Left 1115957736 14:38799664-38799686 CCCCAACAAACTAAAAAGGTTGC No data
Right 1115957743 14:38799709-38799731 TTGGCTTCGGATTAGCATAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115957736 Original CRISPR GCAACCTTTTTAGTTTGTTG GGG (reversed) Intergenic
No off target data available for this crispr