ID: 1115963400

View in Genome Browser
Species Human (GRCh38)
Location 14:38861702-38861724
Sequence ACGAGCTAGTACAATTGTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115963399_1115963400 2 Left 1115963399 14:38861677-38861699 CCTTTTTGATTAGGGAACATTGC No data
Right 1115963400 14:38861702-38861724 ACGAGCTAGTACAATTGTGATGG No data
1115963396_1115963400 20 Left 1115963396 14:38861659-38861681 CCTGTCATTTCTGAGTTTCCTTT No data
Right 1115963400 14:38861702-38861724 ACGAGCTAGTACAATTGTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115963400 Original CRISPR ACGAGCTAGTACAATTGTGA TGG Intergenic
No off target data available for this crispr