ID: 1115969658

View in Genome Browser
Species Human (GRCh38)
Location 14:38931755-38931777
Sequence GGCAAATGATCATGGTGGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115969653_1115969658 -8 Left 1115969653 14:38931740-38931762 CCCCATTAAAAACTTGGCAAATG No data
Right 1115969658 14:38931755-38931777 GGCAAATGATCATGGTGGACAGG No data
1115969654_1115969658 -9 Left 1115969654 14:38931741-38931763 CCCATTAAAAACTTGGCAAATGA No data
Right 1115969658 14:38931755-38931777 GGCAAATGATCATGGTGGACAGG No data
1115969655_1115969658 -10 Left 1115969655 14:38931742-38931764 CCATTAAAAACTTGGCAAATGAT No data
Right 1115969658 14:38931755-38931777 GGCAAATGATCATGGTGGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115969658 Original CRISPR GGCAAATGATCATGGTGGAC AGG Intergenic
No off target data available for this crispr