ID: 1115971200

View in Genome Browser
Species Human (GRCh38)
Location 14:38946587-38946609
Sequence CTCTAGTTCCTTAAGCAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115971200_1115971202 27 Left 1115971200 14:38946587-38946609 CCTTCTTGCTTAAGGAACTAGAG No data
Right 1115971202 14:38946637-38946659 GTCTTAAACTGCGACAAGTACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115971200 Original CRISPR CTCTAGTTCCTTAAGCAAGA AGG (reversed) Intergenic
No off target data available for this crispr