ID: 1115971424

View in Genome Browser
Species Human (GRCh38)
Location 14:38948969-38948991
Sequence AGTAGGTAGTTTTTCAGCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115971424_1115971430 2 Left 1115971424 14:38948969-38948991 CCAGAGCTGAAAAACTACCTACT No data
Right 1115971430 14:38948994-38949016 ATACTATGCCCACTGCCTGGGGG No data
1115971424_1115971427 -1 Left 1115971424 14:38948969-38948991 CCAGAGCTGAAAAACTACCTACT No data
Right 1115971427 14:38948991-38949013 TGGATACTATGCCCACTGCCTGG No data
1115971424_1115971429 1 Left 1115971424 14:38948969-38948991 CCAGAGCTGAAAAACTACCTACT No data
Right 1115971429 14:38948993-38949015 GATACTATGCCCACTGCCTGGGG No data
1115971424_1115971428 0 Left 1115971424 14:38948969-38948991 CCAGAGCTGAAAAACTACCTACT No data
Right 1115971428 14:38948992-38949014 GGATACTATGCCCACTGCCTGGG No data
1115971424_1115971431 7 Left 1115971424 14:38948969-38948991 CCAGAGCTGAAAAACTACCTACT No data
Right 1115971431 14:38948999-38949021 ATGCCCACTGCCTGGGGGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115971424 Original CRISPR AGTAGGTAGTTTTTCAGCTC TGG (reversed) Intergenic
No off target data available for this crispr