ID: 1115971429

View in Genome Browser
Species Human (GRCh38)
Location 14:38948993-38949015
Sequence GATACTATGCCCACTGCCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115971424_1115971429 1 Left 1115971424 14:38948969-38948991 CCAGAGCTGAAAAACTACCTACT No data
Right 1115971429 14:38948993-38949015 GATACTATGCCCACTGCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115971429 Original CRISPR GATACTATGCCCACTGCCTG GGG Intergenic
No off target data available for this crispr