ID: 1115989497

View in Genome Browser
Species Human (GRCh38)
Location 14:39137765-39137787
Sequence GCTTCATTTTCCCACTTTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115989497_1115989506 25 Left 1115989497 14:39137765-39137787 CCAGGAAAGTGGGAAAATGAAGC No data
Right 1115989506 14:39137813-39137835 GGAAGGTGGGAAAGGAAAATGGG No data
1115989497_1115989507 26 Left 1115989497 14:39137765-39137787 CCAGGAAAGTGGGAAAATGAAGC No data
Right 1115989507 14:39137814-39137836 GAAGGTGGGAAAGGAAAATGGGG No data
1115989497_1115989500 8 Left 1115989497 14:39137765-39137787 CCAGGAAAGTGGGAAAATGAAGC No data
Right 1115989500 14:39137796-39137818 TTTCCAGTCTCACTAATGGAAGG No data
1115989497_1115989505 24 Left 1115989497 14:39137765-39137787 CCAGGAAAGTGGGAAAATGAAGC No data
Right 1115989505 14:39137812-39137834 TGGAAGGTGGGAAAGGAAAATGG No data
1115989497_1115989498 4 Left 1115989497 14:39137765-39137787 CCAGGAAAGTGGGAAAATGAAGC No data
Right 1115989498 14:39137792-39137814 CGCCTTTCCAGTCTCACTAATGG No data
1115989497_1115989502 11 Left 1115989497 14:39137765-39137787 CCAGGAAAGTGGGAAAATGAAGC No data
Right 1115989502 14:39137799-39137821 CCAGTCTCACTAATGGAAGGTGG No data
1115989497_1115989504 17 Left 1115989497 14:39137765-39137787 CCAGGAAAGTGGGAAAATGAAGC No data
Right 1115989504 14:39137805-39137827 TCACTAATGGAAGGTGGGAAAGG No data
1115989497_1115989503 12 Left 1115989497 14:39137765-39137787 CCAGGAAAGTGGGAAAATGAAGC No data
Right 1115989503 14:39137800-39137822 CAGTCTCACTAATGGAAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115989497 Original CRISPR GCTTCATTTTCCCACTTTCC TGG (reversed) Intergenic
No off target data available for this crispr