ID: 1115990903

View in Genome Browser
Species Human (GRCh38)
Location 14:39148485-39148507
Sequence AGGGAGAACGAAATGGCTGA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 266
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 240}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115990895_1115990903 19 Left 1115990895 14:39148443-39148465 CCAAAAAAAAAGAAAAAAAAAAT 0: 10
1: 763
2: 16733
3: 22410
4: 47980
Right 1115990903 14:39148485-39148507 AGGGAGAACGAAATGGCTGATGG 0: 1
1: 0
2: 0
3: 25
4: 240

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115990903 Original CRISPR AGGGAGAACGAAATGGCTGA TGG Exonic
900489029 1:2937126-2937148 AATGAGAAGGAAATGGCTAAGGG - Intergenic
900852668 1:5156293-5156315 AGGGAGGAAGAAATGGATTACGG - Intergenic
901379317 1:8862491-8862513 AGGGAGGAAGAAAAGGCCGAAGG - Intronic
904696437 1:32334407-32334429 GAGGAGAACCAGATGGCTGATGG + Exonic
904840790 1:33370643-33370665 GGGGAGAAAGAAATGGATGAGGG - Intronic
904893852 1:33799508-33799530 AGGGAGAAATAAATGGAGGAAGG - Intronic
905146729 1:35893067-35893089 AGGGTGAAAGAAAGGGATGAAGG - Intronic
905562862 1:38941349-38941371 GGGGAGAACGTGATGGCTGGAGG + Intronic
907078039 1:51595542-51595564 AGGGAGGAAGAAATGGGGGAGGG + Intronic
907262479 1:53230347-53230369 AGGGAGAACAGAATGGGAGATGG - Intronic
908767251 1:67565311-67565333 AGAGAGAGAGAATTGGCTGAAGG + Intergenic
909197348 1:72644671-72644693 AGGGAGAAGTACATGGCTGGAGG - Intergenic
909622264 1:77682400-77682422 GGGGAGAAGGACCTGGCTGAGGG + Intronic
910163294 1:84297551-84297573 AAGGAGAAGGAAAAGGCAGATGG - Intergenic
910938156 1:92504123-92504145 TGGGAGAGGGAAATGGCTCACGG + Intergenic
912606492 1:110995198-110995220 AGGCAGAACCAGATGGTTGAGGG - Intergenic
915003769 1:152617708-152617730 AGGCAGAAAGAAAGGTCTGAAGG + Intergenic
915770081 1:158412011-158412033 AGGGAGAAAGAACTGACTCAAGG + Intergenic
916769522 1:167894560-167894582 AGGGAGACAGAAATGGCAAAGGG + Intronic
916790083 1:168117198-168117220 AGGAAGAACGGAATGGATTAAGG - Intronic
919534229 1:198766896-198766918 AGGGAGAAAGAAATAAATGAAGG + Intergenic
920199228 1:204249292-204249314 AGGGAGAAAGAAGGGGATGAAGG + Intronic
922550837 1:226493255-226493277 AAGGTGATGGAAATGGCTGATGG - Intergenic
923012159 1:230096454-230096476 GGGGAGAACGAGATGGACGAGGG - Intronic
923369493 1:233295845-233295867 AGAGAGAAAGAAAAGGCTGGAGG - Intergenic
1063956181 10:11269811-11269833 AGTGAGAAAGAAATGGCTAAAGG - Intronic
1066543143 10:36470972-36470994 AGGCAGAACAAAATGGCCAAGGG - Intergenic
1068571041 10:58629542-58629564 AGGGACAACCAAAAGGCTGGGGG + Intronic
1070828865 10:79406651-79406673 AGGGAGGATGAAATGGCTGGTGG - Intronic
1071571363 10:86699185-86699207 AGGGAGAATGAAAGGGGTTAGGG - Intronic
1073127958 10:101163660-101163682 AGGGAGAAAGGAGGGGCTGATGG - Intergenic
1073154432 10:101335216-101335238 AGGGAGACAGAAAGGGCAGAGGG - Intergenic
1073857826 10:107697618-107697640 AGGGAGGAGGAAATGGAGGAGGG - Intergenic
1075619698 10:123916749-123916771 AGAGAGAATCAAATGGCAGAAGG - Intronic
1076750969 10:132542785-132542807 AAGGAAAAAGAAATGGGTGAGGG - Intronic
1076886063 10:133262962-133262984 GGGGAGAAGGAATTGGCTGAGGG + Exonic
1081259637 11:40943866-40943888 AGGGAGAGCTAAATGGGTCAGGG - Intronic
1081874279 11:46397963-46397985 AGAGAGAGCGAATTGGCTGCTGG + Intronic
1082874377 11:57972957-57972979 AGGAGGAAGGAAGTGGCTGAGGG - Intergenic
1083299268 11:61731825-61731847 GGGCAGAAGGGAATGGCTGAGGG - Intronic
1084111167 11:67015076-67015098 AGAGAGACCGAATTGGGTGAAGG - Intronic
1085371495 11:76010896-76010918 AGGAAGTAGGAAATGCCTGAGGG + Intronic
1085501556 11:77029459-77029481 AGAGAGAGCTACATGGCTGAGGG + Intergenic
1090476017 11:127021037-127021059 AGGGAGAAATCAGTGGCTGAAGG + Intergenic
1092047824 12:5444783-5444805 ATGAAGAAAGGAATGGCTGATGG + Intronic
1092173658 12:6388772-6388794 ATGGAGAATGAAATGGGTGTAGG - Intronic
1094069255 12:26394985-26395007 AGGGAGACAGAAAGGGATGATGG + Intronic
1095239592 12:39840940-39840962 ATGGAGAACGAGGTGTCTGATGG - Intronic
1097908811 12:64947685-64947707 ATGGAGAAGGGAAAGGCTGAAGG - Intergenic
1103522455 12:121545611-121545633 AGGGAGAGCGGAGGGGCTGAGGG - Intronic
1105204141 13:18205870-18205892 AGTGAGAACAAAATCCCTGAGGG - Intergenic
1105255230 13:18739799-18739821 AGGGACCTCGAAGTGGCTGAAGG - Intergenic
1106225557 13:27783725-27783747 AGAGAAAAGGAAATGGCTGGGGG + Intergenic
1106350213 13:28922631-28922653 AGGGAGAGCGCAATGACTGGGGG - Intronic
1109855566 13:68122761-68122783 AGGGAGAAATAAATGGCAGAAGG + Intergenic
1113074391 13:106453465-106453487 AGGGAGAAGGAAACTGCTGAGGG + Intergenic
1113677139 13:112214989-112215011 AGGGAGATGGAGAGGGCTGAAGG + Intergenic
1113677158 13:112215045-112215067 AGGGAGATGGAGAGGGCTGAAGG + Intergenic
1113677177 13:112215101-112215123 AGGGAGATGGAGAGGGCTGAAGG + Intergenic
1113677196 13:112215157-112215179 AGGGAGATGGAGAGGGCTGAAGG + Intergenic
1113677215 13:112215213-112215235 AGGGAGATGGAGAGGGCTGAAGG + Intergenic
1114043684 14:18702929-18702951 AGAGAGAACTAGATGGCTGTGGG - Intergenic
1114047970 14:18893371-18893393 AGAGAGAACTAGATGGCTGTGGG - Intergenic
1114114548 14:19508272-19508294 AGAGAGAACTAGATGGCTGTGGG + Intergenic
1114116245 14:19626035-19626057 AGAGAGAACTAGATGGCTGTGGG + Intergenic
1115990903 14:39148485-39148507 AGGGAGAACGAAATGGCTGATGG + Exonic
1116208366 14:41899979-41900001 AGAGAGAACAAAAGGGGTGATGG - Intronic
1117384369 14:55195809-55195831 AGGGAGAGCGCAGTGACTGATGG - Intergenic
1118457656 14:65959214-65959236 AGGCAGAACAGGATGGCTGAGGG - Intronic
1118612724 14:67554117-67554139 AAGGAGAAAAAAATGGATGAGGG + Intronic
1119907798 14:78321316-78321338 AGGGAGAAGTAAATGGGTCAGGG + Intronic
1120590318 14:86366318-86366340 AGGGAGAAAGAAAGGGAGGAAGG + Intergenic
1121431181 14:93889527-93889549 AGGGAGAACGAAACCCCTGGGGG + Intergenic
1121950680 14:98168261-98168283 AGAGAAAAAGAAATGGCTCAGGG + Intergenic
1122079511 14:99257258-99257280 GGGGAGGCCCAAATGGCTGATGG - Intronic
1122793274 14:104193387-104193409 AGGGAGGAGGACAGGGCTGAGGG - Intergenic
1124153100 15:27199912-27199934 AGGGAAAGAGAAATGGCTGAAGG - Intronic
1126320674 15:47419451-47419473 AGGGAGAATGAACTGGAGGATGG + Intronic
1127428832 15:58882256-58882278 AGGGTGAATGAAATGGATGGTGG + Intronic
1127556019 15:60088516-60088538 AGGGAGAACGAGAGAGATGAAGG + Intergenic
1132587254 16:710948-710970 GGGGAGAACGCAGTGGCCGAAGG + Intronic
1133468167 16:6048002-6048024 AGAGAGAAGGAAATGCCTCATGG + Intronic
1136469006 16:30465946-30465968 AGAGAGAACGAGATCTCTGATGG + Intergenic
1142087466 16:88191527-88191549 AGAGAATACGAAAGGGCTGAAGG + Intergenic
1142674252 17:1503809-1503831 AGGGAGGGCAAAAGGGCTGAGGG - Intronic
1143186787 17:5014829-5014851 ATGGAGAAGGTAATGGCTGAGGG + Exonic
1144664475 17:17092548-17092570 AAGGAGAAAGAAAAGGATGAGGG - Intronic
1146093078 17:29901751-29901773 AGGGAGAAAGAAAGGGAGGAAGG - Intronic
1146189236 17:30750234-30750256 AGGGTGAACAAAATGGATGAAGG + Intergenic
1146334125 17:31954537-31954559 AGGGTGAACAAAATGGATGAAGG + Intronic
1149485883 17:57042459-57042481 AGGGAGAAAGAAAGGGAGGAAGG - Intergenic
1150464380 17:65379611-65379633 AGGGACAAAGAAATGGAGGAAGG + Intergenic
1150651752 17:67014963-67014985 AGAAAGAAAGAAATAGCTGAAGG + Intronic
1150808966 17:68341560-68341582 ACGGAGAAAGAACTGGATGACGG - Intronic
1151250086 17:72827675-72827697 GGTGAGAATGAGATGGCTGAAGG - Intronic
1153768254 18:8395300-8395322 AGGGAGGAAGAGATGGCCGATGG + Intronic
1154435791 18:14340803-14340825 AGGGACCTCGAAGTGGCTGAAGG + Intergenic
1155527519 18:26731982-26732004 AGGGAAAAAGAAATAGGTGAAGG + Intergenic
1156069638 18:33190948-33190970 AGTGAGAAGCAAATTGCTGATGG - Intronic
1157514268 18:48299689-48299711 AGGGAGGATGAAGAGGCTGAAGG + Intronic
1158658003 18:59358804-59358826 AGAGAGAACAGAATGGGTGAGGG + Intronic
1158692013 18:59669358-59669380 AAGGAAAACGAGATGGCTGGTGG - Intronic
1159900460 18:74040147-74040169 AGGGAGAACAAAGGGGCTCAAGG - Intergenic
1159914403 18:74175827-74175849 TGGGAGAACTAAATGGAGGAGGG + Intergenic
1162189027 19:8930244-8930266 ACGGGGAAAGAAATGGGTGAGGG - Intronic
1163350682 19:16774736-16774758 AGGAAGAAAGAAAGGGTTGAAGG - Intronic
1163411775 19:17159353-17159375 AGGGAGAAGGAAAAGGGAGATGG - Intronic
1165577894 19:36837436-36837458 AGGGAGGAAGAAAGGTCTGAAGG - Intronic
1165796631 19:38523662-38523684 AGGAAGAAAGAAATGGAAGAGGG - Intronic
1166388597 19:42396493-42396515 AGGGAGAAGGAAGAGGCTCAGGG - Intergenic
1167505356 19:49868381-49868403 AGGGAAAAAAAAATGGCTGGAGG - Intergenic
1167671787 19:50857765-50857787 AGAGAGAATGAAAGGGCAGAGGG - Intronic
1167798204 19:51724360-51724382 AGGGAGAAAGAAAGGGATGGAGG - Intergenic
927967328 2:27279022-27279044 AGAAAGAAAGAAATGGTTGAGGG + Intronic
928157903 2:28893742-28893764 AGGTAGAACGAAAGGTTTGAAGG - Intergenic
929080071 2:38113671-38113693 AGGGAGAACCAAAGAGGTGAGGG + Intergenic
929278069 2:40046796-40046818 AGGGATAATCAAGTGGCTGAAGG - Intergenic
929977702 2:46651472-46651494 GGGGAGAACGAAAATGCAGAGGG + Intergenic
930321945 2:49865919-49865941 AGGGAGAGGGAAATGGTAGAGGG - Intergenic
930594016 2:53363725-53363747 AGGGAGAAAGAAAATGCTGCTGG + Intergenic
931295914 2:60925603-60925625 AGGGAGAAAGAAAAACCTGAAGG + Exonic
934699069 2:96423962-96423984 AGGGGGACTGAAATGGCTGAGGG - Intergenic
934902314 2:98170404-98170426 AAAGACAAGGAAATGGCTGAAGG + Intronic
935263310 2:101373729-101373751 AGGGAGAAAGAAGTGACTGCAGG + Intronic
935666165 2:105514930-105514952 AGGGAGAAAGAAAGGAGTGACGG - Intergenic
939402265 2:141709723-141709745 AGGGAAAAAGAGATGGCTAAGGG + Intronic
940672644 2:156689294-156689316 AGGTTGAACTAAATGACTGAAGG + Intergenic
941087527 2:161134952-161134974 AGGGAGAGAAGAATGGCTGAGGG - Intergenic
942925042 2:181421403-181421425 AAGGAGAAAGAAATGAGTGATGG + Intergenic
945787425 2:214259572-214259594 TGGAAGAAGGAAATGGCTCAGGG - Intronic
945812795 2:214568944-214568966 AGGGAGAAGAAAAGGGCTGGAGG - Intronic
946814964 2:223567461-223567483 AGAAAGAAAGAAAAGGCTGAAGG - Intergenic
948453426 2:238092824-238092846 AGGCAGAAAGGAATGGGTGAGGG - Intronic
948847604 2:240690602-240690624 GGGGAGAAGGAAAGGGCTGCGGG + Intergenic
1168953220 20:1816904-1816926 AGGGAGAGCCTAAGGGCTGATGG - Intergenic
1170038687 20:12017594-12017616 AGGTAGAAGGAAATGGTTGATGG + Intergenic
1171487106 20:25493293-25493315 CGGGAGAACGAAGTCGCTGGAGG + Intronic
1172776141 20:37408118-37408140 AGGCAGAAAGGAAAGGCTGAGGG - Intergenic
1173496936 20:43526255-43526277 AGGGAGGAAGAAATGGCTGTTGG + Intronic
1173743459 20:45418991-45419013 AGGAAGAAGGAAAGGGCTGTAGG - Intronic
1174531621 20:51219112-51219134 AGGGAGACAGAAATGACTGCTGG + Intergenic
1176713833 21:10332211-10332233 AGTGAGAACAAAATCCCTGAGGG + Intergenic
1178628170 21:34235907-34235929 ATGGGGATCGAAAGGGCTGATGG + Intergenic
1179597852 21:42455080-42455102 AAGGAGAACAAAATGGCTCAAGG - Intergenic
1179675774 21:42981064-42981086 AGGGTGAAGGAAGTGGCTGCAGG + Intronic
1179909289 21:44439368-44439390 AGGGAGGGCGAGATGTCTGAGGG - Intronic
1180466506 22:15616047-15616069 AGAGAGAACTAGATGGCTGTGGG - Intergenic
1182959055 22:34454951-34454973 TGGGAGAACGAAAGTGCTGAAGG + Intergenic
1183430232 22:37761580-37761602 AGGCATTAGGAAATGGCTGAAGG + Intronic
1183577019 22:38698072-38698094 AGGGAGAAGGAAAGGACTCAGGG - Intronic
1184350696 22:43941892-43941914 AGGGAGAACGAAGAGCCTGAAGG + Intronic
1184813703 22:46854580-46854602 AGGCAGAAAGGAAAGGCTGAAGG - Intronic
1184874504 22:47264964-47264986 AGACAGAATCAAATGGCTGATGG + Intergenic
949908785 3:8882591-8882613 CAGGAGCAGGAAATGGCTGAGGG + Intronic
950357850 3:12426562-12426584 AGGGAAAAGAAAAAGGCTGAAGG + Intronic
953131674 3:40145475-40145497 AAGGAGAATGAAAGGGCAGAAGG - Intronic
953774560 3:45804123-45804145 AGGGAGAGAGGAATGACTGACGG - Intergenic
954491478 3:50910709-50910731 AGGGAGAACAAAGTGACTGTGGG - Intronic
955033247 3:55241137-55241159 AGGAAGAACGAGATGCTTGAGGG + Intergenic
958071716 3:88622690-88622712 AGCGAGAACCAAACGGCTGATGG + Intergenic
961225107 3:125237105-125237127 AGGGAGACTGAATTGACTGAAGG + Intronic
961569276 3:127786477-127786499 AGGGAGAAGGCAATGACTGTGGG + Intronic
963626512 3:147679927-147679949 AAGGACAACAAAATGTCTGAAGG - Intergenic
964681552 3:159345682-159345704 AGGGAGAATAAAATAGGTGAGGG - Intronic
965064493 3:163829224-163829246 TGGGAGAACTAGATGGCTGCTGG - Intergenic
969087034 4:4664220-4664242 AGGGAGAACAGACTAGCTGAGGG + Intergenic
969468881 4:7374781-7374803 AGGGAGCACAAGATGGCTGTGGG - Intronic
969928084 4:10603970-10603992 AAGGAGAAAGGAAGGGCTGAAGG + Intronic
970587637 4:17529847-17529869 TGGGAGAATGAAATGTCTGGAGG - Intergenic
975098254 4:70482174-70482196 AGGGAAAAGTAAATGGTTGATGG - Exonic
976442857 4:85096158-85096180 AGGGGGAAAGAAATGGAAGAAGG - Intergenic
978050386 4:104191632-104191654 AGGGAAGAAAAAATGGCTGAAGG - Intergenic
978619137 4:110622073-110622095 AGGGAGAACTAAAGGGATGCGGG + Intronic
980470957 4:133250870-133250892 AGGAAAAACGAGATGGGTGAGGG + Intergenic
982793911 4:159623274-159623296 AGGGAGATTGAAATTGATGAAGG + Intergenic
987124855 5:14802690-14802712 AGGGAGAATGGGATGGCTGAGGG - Intronic
988085452 5:26469684-26469706 TGGAAGAAAGAAAAGGCTGATGG - Intergenic
988458187 5:31406864-31406886 AGGGAGAAAGAATAGGCTGTGGG - Exonic
988955282 5:36310293-36310315 AGGAAGTAGGAAATGGCTGTTGG - Intergenic
989404823 5:41048639-41048661 AGGGAAAAAGAAATGGGAGAAGG - Intronic
989552056 5:42746904-42746926 AGGGAAAAAGAAATAACTGAAGG + Intergenic
989987450 5:50717858-50717880 AGGGAGAGAGAAGTGACTGATGG + Intronic
991429573 5:66530356-66530378 AGGGAGAAAGGAAGGGCGGAAGG - Intergenic
991450307 5:66744043-66744065 AAAGAGAAGGAAATGACTGAGGG - Intronic
993481757 5:88432250-88432272 AAGGATAAAGAAATGGATGAAGG - Intergenic
993511498 5:88776826-88776848 AGGATGAACAAAATTGCTGATGG - Intronic
994265520 5:97711445-97711467 AGGGAGAGAGAAATGGAGGAAGG - Intergenic
995479062 5:112577114-112577136 GGGGAGCACTAAATTGCTGATGG + Intergenic
996582245 5:125044422-125044444 AAGGAGAACGAAGTGGATGTTGG - Intergenic
998182362 5:139954366-139954388 AGGAAGAATGAAATGACTGGAGG + Intronic
1000054274 5:157590899-157590921 AGGGAGAATGAAATTGATAAAGG - Intergenic
1002558249 5:180061182-180061204 AGGCTGAATGAAATGGCTGATGG + Intronic
1003486190 6:6581665-6581687 AGGGAGAGGGGAAAGGCTGAGGG - Intergenic
1003663702 6:8088890-8088912 AGGGAGAAGGAAGGGGCTTAAGG + Intronic
1004089728 6:12488696-12488718 AGAGAGAAAGAAAGGGCTGGGGG + Intergenic
1005585967 6:27276904-27276926 CGGGAGAAGGAAGGGGCTGAGGG + Intergenic
1006034836 6:31202954-31202976 TGGGAGAAGGAAAAGGCTTATGG + Exonic
1008694206 6:54015029-54015051 AGGGAGAAAGAAATGGATTTAGG - Intronic
1009789192 6:68379194-68379216 AGGGAGATGGAAATGGTTAATGG - Intergenic
1011282671 6:85692145-85692167 AGGAAGAAAGAAAGGGCTGGAGG + Intergenic
1011326313 6:86152541-86152563 ATGGGGAACCAAATGGCAGATGG + Intergenic
1012073796 6:94657774-94657796 AGGGAGAAAGCAGTGACTGATGG - Intergenic
1012946508 6:105471704-105471726 AGGGAGAATGAAAAGGTTCAGGG + Intergenic
1013530181 6:111012028-111012050 AGGGAGCAAGAAATGTATGAAGG + Intronic
1015073418 6:129125116-129125138 TGTGAGAATGAGATGGCTGAGGG + Intronic
1015178055 6:130332751-130332773 AAGGAGAAAGAATTAGCTGAGGG + Intronic
1015344927 6:132145095-132145117 AGAGAGAAGGAAAAGACTGAAGG - Intergenic
1016393220 6:143595865-143595887 AGGGAGAAGGAAAAGGTTAAAGG - Intronic
1021507871 7:21405230-21405252 AGGGAGAATGAACAGGCTGGAGG + Intergenic
1022588298 7:31636671-31636693 AGGGAGAACTAACAGGCTGTGGG + Intronic
1023394863 7:39743333-39743355 AGGGAGAAAGTAAAAGCTGAAGG - Intergenic
1024358928 7:48447368-48447390 AGGGAGAAAGAAATGGATTATGG - Intronic
1025085922 7:56023177-56023199 AAGGAGAACGAAAATGGTGAAGG + Intronic
1026209424 7:68290460-68290482 AGATAGAACGAAAAGGCTGAGGG - Intergenic
1029379738 7:100205195-100205217 AGGTAGAACCAAAAGCCTGAAGG - Intronic
1029961475 7:104692784-104692806 ATGGAGAAGGAAATTGCAGAAGG + Intronic
1030922723 7:115412220-115412242 AGGAAGAAGGAAATGGCTACTGG + Intergenic
1031589703 7:123574584-123574606 TGGCAGTAGGAAATGGCTGAAGG - Intronic
1031837500 7:126695985-126696007 AGGGATAAAGAAAAGGGTGAAGG + Intronic
1036756987 8:11477310-11477332 AGGGAGGAGCAAGTGGCTGAAGG + Intergenic
1037254250 8:16934532-16934554 AGGTAGAACAAAATGGCTAGCGG - Intergenic
1037924657 8:22834741-22834763 AGGAAGAAGGAAATGAGTGAGGG - Intronic
1038222773 8:25626585-25626607 AGTGTGAAAAAAATGGCTGAGGG + Intergenic
1038583364 8:28769289-28769311 AGGAAGAAGGAATTGGCTAAAGG - Intronic
1038725943 8:30082808-30082830 AGGGCGAACGAAGCGCCTGAGGG + Intronic
1038843635 8:31209239-31209261 AGGGACAAGGAAATGGCAGAAGG - Intergenic
1041714730 8:60922989-60923011 AGGGAGAACGGAAAAGATGAGGG + Intergenic
1041750712 8:61258023-61258045 AGGAAGAAAGAAATGCATGAAGG + Intronic
1042024961 8:64413658-64413680 AGGGAGAAGGGAGGGGCTGATGG - Intergenic
1044904268 8:96983068-96983090 AGGGAGAAGGAAATGGATTGTGG - Intronic
1046420700 8:113980043-113980065 AGGGTGAATGAAAGGGCTGGGGG + Intergenic
1046740423 8:117821871-117821893 AGGGAAAAGGGAATGGCGGAGGG - Intronic
1047447104 8:124929232-124929254 AGAGAGGACGAGATGGCTCAGGG + Intergenic
1051043032 9:12837827-12837849 AGGGAGAAGGAAATGGCATATGG - Intergenic
1051088712 9:13381285-13381307 AGGGAGCAGGAAATAGCTGTTGG + Intergenic
1051685227 9:19651559-19651581 AGAGAGAAAGAAATTGATGATGG - Intronic
1053329808 9:37193815-37193837 AGGGAGAAAGAAATTCCTGAAGG - Intronic
1055364626 9:75529224-75529246 GGGCAGAACTAAATGGATGAAGG - Intergenic
1055870074 9:80866306-80866328 AGGGGAGACAAAATGGCTGAGGG + Intergenic
1056006147 9:82273460-82273482 AGGCAGAACAACATGACTGAAGG + Intergenic
1056508222 9:87277698-87277720 AGAGAGAGAGAAATAGCTGAAGG - Intergenic
1058263255 9:102863729-102863751 TGGGAGAAGGAACTTGCTGAGGG + Intergenic
1058728143 9:107823403-107823425 AGGAAGAAGGAAATGGCAGTAGG + Intergenic
1060245380 9:121941713-121941735 AGGGAGAACTAGAAGGCTGCAGG - Intronic
1060442555 9:123655312-123655334 ACGGAGGAAGCAATGGCTGAGGG + Intronic
1060521780 9:124298186-124298208 AGGGAGAAAGGAAGGGATGAGGG - Intronic
1062066607 9:134531339-134531361 AGGGAGAATGAGATGCCAGAAGG + Intergenic
1062096337 9:134705898-134705920 ATGGGGAAAGAACTGGCTGAGGG + Intronic
1062675746 9:137742679-137742701 AGGGAGAAGCAAATGTCTGGGGG - Intronic
1186333689 X:8563584-8563606 AGAGAGAAAGAAATGGCTTTTGG - Intronic
1186497621 X:10024495-10024517 AGGGAGAACCGAATGGCTCGGGG - Intronic
1188041210 X:25371595-25371617 AGTGAGAAAGTAATGGCAGAAGG + Intergenic
1188630640 X:32355093-32355115 AGGGAGGAAGAAATGGAAGAAGG - Intronic
1189004199 X:36978955-36978977 AGGAAGAAGGAAATGGCTATTGG - Intergenic
1189044726 X:37578338-37578360 AGGGAGAAGGAAATGGTTGCTGG + Intronic
1189846237 X:45141454-45141476 AGGGAGAGCGAGATGGAGGAGGG + Intergenic
1189921250 X:45905047-45905069 GAGGAGAAATAAATGGCTGAAGG - Intergenic
1190203143 X:48381325-48381347 AGGGAGAACGGAAGGGAAGAAGG - Intergenic
1190207395 X:48414084-48414106 AGGGAGAACGGAAGGGAAGAAGG + Intergenic
1194603661 X:95955639-95955661 AGGGAAAACTAAATGGCACATGG + Intergenic
1195625864 X:107005419-107005441 AGGGAGGAAGAAATGGCAGTGGG - Intergenic
1196129963 X:112144824-112144846 AGGGAGGAAGTAATGGCTGCAGG - Intergenic
1196779910 X:119374639-119374661 AGGAAGAATGAAATGGGTCAGGG + Intergenic
1196780011 X:119375418-119375440 AGGGACAATTAAGTGGCTGAGGG + Intergenic
1199978402 X:152907578-152907600 AGGGAGAAAGAAGGGGATGAAGG + Intergenic
1200172697 X:154089566-154089588 AGAGACAACGAAATGCATGACGG + Intronic