ID: 1115999587

View in Genome Browser
Species Human (GRCh38)
Location 14:39228729-39228751
Sequence TTAGGAGAGGACGGCTGAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115999587_1115999594 16 Left 1115999587 14:39228729-39228751 CCTGTTCAGCCGTCCTCTCCTAA No data
Right 1115999594 14:39228768-39228790 GGTCACATTCCTGCCTGCCTGGG No data
1115999587_1115999595 17 Left 1115999587 14:39228729-39228751 CCTGTTCAGCCGTCCTCTCCTAA No data
Right 1115999595 14:39228769-39228791 GTCACATTCCTGCCTGCCTGGGG No data
1115999587_1115999593 15 Left 1115999587 14:39228729-39228751 CCTGTTCAGCCGTCCTCTCCTAA No data
Right 1115999593 14:39228767-39228789 TGGTCACATTCCTGCCTGCCTGG No data
1115999587_1115999591 -5 Left 1115999587 14:39228729-39228751 CCTGTTCAGCCGTCCTCTCCTAA No data
Right 1115999591 14:39228747-39228769 CCTAAGCTCTTTCCAGTCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115999587 Original CRISPR TTAGGAGAGGACGGCTGAAC AGG (reversed) Intergenic