ID: 1115999589

View in Genome Browser
Species Human (GRCh38)
Location 14:39228742-39228764
Sequence GACTGGAAAGAGCTTAGGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115999589_1115999593 2 Left 1115999589 14:39228742-39228764 CCTCTCCTAAGCTCTTTCCAGTC No data
Right 1115999593 14:39228767-39228789 TGGTCACATTCCTGCCTGCCTGG No data
1115999589_1115999599 23 Left 1115999589 14:39228742-39228764 CCTCTCCTAAGCTCTTTCCAGTC No data
Right 1115999599 14:39228788-39228810 GGGGATGTTACATCCTTTGTTGG No data
1115999589_1115999594 3 Left 1115999589 14:39228742-39228764 CCTCTCCTAAGCTCTTTCCAGTC No data
Right 1115999594 14:39228768-39228790 GGTCACATTCCTGCCTGCCTGGG No data
1115999589_1115999595 4 Left 1115999589 14:39228742-39228764 CCTCTCCTAAGCTCTTTCCAGTC No data
Right 1115999595 14:39228769-39228791 GTCACATTCCTGCCTGCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115999589 Original CRISPR GACTGGAAAGAGCTTAGGAG AGG (reversed) Intergenic
No off target data available for this crispr