ID: 1115999592

View in Genome Browser
Species Human (GRCh38)
Location 14:39228759-39228781
Sequence GCAGGAATGTGACCACTGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115999592_1115999599 6 Left 1115999592 14:39228759-39228781 CCAGTCAGTGGTCACATTCCTGC No data
Right 1115999599 14:39228788-39228810 GGGGATGTTACATCCTTTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115999592 Original CRISPR GCAGGAATGTGACCACTGAC TGG (reversed) Intergenic