ID: 1115999594

View in Genome Browser
Species Human (GRCh38)
Location 14:39228768-39228790
Sequence GGTCACATTCCTGCCTGCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115999588_1115999594 7 Left 1115999588 14:39228738-39228760 CCGTCCTCTCCTAAGCTCTTTCC No data
Right 1115999594 14:39228768-39228790 GGTCACATTCCTGCCTGCCTGGG No data
1115999587_1115999594 16 Left 1115999587 14:39228729-39228751 CCTGTTCAGCCGTCCTCTCCTAA No data
Right 1115999594 14:39228768-39228790 GGTCACATTCCTGCCTGCCTGGG No data
1115999590_1115999594 -2 Left 1115999590 14:39228747-39228769 CCTAAGCTCTTTCCAGTCAGTGG No data
Right 1115999594 14:39228768-39228790 GGTCACATTCCTGCCTGCCTGGG No data
1115999589_1115999594 3 Left 1115999589 14:39228742-39228764 CCTCTCCTAAGCTCTTTCCAGTC No data
Right 1115999594 14:39228768-39228790 GGTCACATTCCTGCCTGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115999594 Original CRISPR GGTCACATTCCTGCCTGCCT GGG Intergenic