ID: 1115999595

View in Genome Browser
Species Human (GRCh38)
Location 14:39228769-39228791
Sequence GTCACATTCCTGCCTGCCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115999589_1115999595 4 Left 1115999589 14:39228742-39228764 CCTCTCCTAAGCTCTTTCCAGTC No data
Right 1115999595 14:39228769-39228791 GTCACATTCCTGCCTGCCTGGGG No data
1115999588_1115999595 8 Left 1115999588 14:39228738-39228760 CCGTCCTCTCCTAAGCTCTTTCC No data
Right 1115999595 14:39228769-39228791 GTCACATTCCTGCCTGCCTGGGG No data
1115999590_1115999595 -1 Left 1115999590 14:39228747-39228769 CCTAAGCTCTTTCCAGTCAGTGG No data
Right 1115999595 14:39228769-39228791 GTCACATTCCTGCCTGCCTGGGG No data
1115999587_1115999595 17 Left 1115999587 14:39228729-39228751 CCTGTTCAGCCGTCCTCTCCTAA No data
Right 1115999595 14:39228769-39228791 GTCACATTCCTGCCTGCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115999595 Original CRISPR GTCACATTCCTGCCTGCCTG GGG Intergenic