ID: 1115999599

View in Genome Browser
Species Human (GRCh38)
Location 14:39228788-39228810
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115999588_1115999599 27 Left 1115999588 14:39228738-39228760 CCGTCCTCTCCTAAGCTCTTTCC No data
Right 1115999599 14:39228788-39228810 GGGGATGTTACATCCTTTGTTGG No data
1115999590_1115999599 18 Left 1115999590 14:39228747-39228769 CCTAAGCTCTTTCCAGTCAGTGG No data
Right 1115999599 14:39228788-39228810 GGGGATGTTACATCCTTTGTTGG No data
1115999592_1115999599 6 Left 1115999592 14:39228759-39228781 CCAGTCAGTGGTCACATTCCTGC No data
Right 1115999599 14:39228788-39228810 GGGGATGTTACATCCTTTGTTGG No data
1115999589_1115999599 23 Left 1115999589 14:39228742-39228764 CCTCTCCTAAGCTCTTTCCAGTC No data
Right 1115999599 14:39228788-39228810 GGGGATGTTACATCCTTTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115999599 Original CRISPR GGGGATGTTACATCCTTTGT TGG Intergenic