ID: 1116006522

View in Genome Browser
Species Human (GRCh38)
Location 14:39297462-39297484
Sequence CTCCCAAATGGGAAATGTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 4, 3: 14, 4: 190}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116006522_1116006530 26 Left 1116006522 14:39297462-39297484 CCTCCACATTTCCCATTTGGGAG 0: 1
1: 0
2: 4
3: 14
4: 190
Right 1116006530 14:39297511-39297533 GCAACTTAGGTAAAGAATGCTGG 0: 1
1: 0
2: 0
3: 10
4: 113
1116006522_1116006528 13 Left 1116006522 14:39297462-39297484 CCTCCACATTTCCCATTTGGGAG 0: 1
1: 0
2: 4
3: 14
4: 190
Right 1116006528 14:39297498-39297520 TGCCAACAGTCTTGCAACTTAGG 0: 1
1: 0
2: 1
3: 13
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116006522 Original CRISPR CTCCCAAATGGGAAATGTGG AGG (reversed) Intronic
900698037 1:4024447-4024469 CTCCCAAATATGAATTTTGGGGG - Intergenic
901330780 1:8406466-8406488 CTCTCAAATGGTTCATGTGGGGG + Intronic
902633965 1:17723097-17723119 GTCCAAAGGGGGAAATGTGGTGG - Intergenic
906118725 1:43373184-43373206 CTGACTAATGGGAAATGAGGTGG + Intergenic
908052930 1:60252110-60252132 CTACCAATTGGGCACTGTGGTGG + Intergenic
911449405 1:98045449-98045471 CTTCCAGATCGGAAGTGTGGCGG - Intergenic
912196967 1:107409459-107409481 CTCAGATATGGGGAATGTGGTGG - Intronic
913160371 1:116139734-116139756 CTCCAAAATGGGCATTGTGATGG + Intergenic
913292728 1:117289812-117289834 CTGCTAAATGGGAAAAGTGGTGG + Intergenic
914913579 1:151804901-151804923 CTGACAAATGGGAACTGTGTGGG + Intronic
919019537 1:192086238-192086260 CTCCTAAAGGGGAAATATGCAGG + Intergenic
919286409 1:195567399-195567421 TTCCCAAATGGGAAAAGAGAGGG + Intergenic
919489752 1:198192208-198192230 CAGCCAAATAAGAAATGTGGGGG - Intronic
919551933 1:199001258-199001280 GTACCAAAAGGGAAATGTGGAGG + Intergenic
921812145 1:219527323-219527345 CTTCCAAATGGGAAAAAAGGGGG - Intergenic
924151206 1:241131988-241132010 ATCCCAACTGGAAAATGTGATGG + Intronic
924378966 1:243443576-243443598 CTTACAAATGAGAACTGTGGAGG - Intronic
924596235 1:245447415-245447437 TTCCCATATGGGAATTGTAGGGG - Intronic
924835007 1:247639077-247639099 CTGCCATAGGGGAAAAGTGGAGG + Intergenic
1062932591 10:1362950-1362972 CTCCCAACAGGGAAAGGTCGGGG + Intronic
1063758871 10:9048481-9048503 CTACCAAAAGGGAAATGTGGAGG - Intergenic
1065007158 10:21390588-21390610 CATCTGAATGGGAAATGTGGGGG + Intergenic
1068320265 10:55404127-55404149 ATCCCAAGAGGAAAATGTGGGGG - Intronic
1068533638 10:58215997-58216019 CTCCCCAATGTGAAAAGTGAGGG - Intronic
1070984228 10:80674215-80674237 CTGGCAATTGTGAAATGTGGAGG - Intergenic
1071996479 10:91153977-91153999 CTCCCAAATGGAAAGTGCTGGGG + Intergenic
1072764000 10:98081332-98081354 CTCCCAAAGGGGATTTGAGGGGG + Intergenic
1075081820 10:119389375-119389397 CCCCAAAATGGGAAGAGTGGAGG + Intronic
1077246975 11:1544459-1544481 CTGCAAAATGGGAATTGGGGAGG - Intergenic
1077292710 11:1805971-1805993 CTCCCAAATAAGAAATCTCGAGG + Intergenic
1078412197 11:11133888-11133910 ATGCCAACTGGTAAATGTGGAGG + Intergenic
1079031084 11:16987060-16987082 GCCCCAAATGGGAAATTTGCAGG + Intronic
1079366717 11:19816228-19816250 CTCCCAAATGGGGAAGGAGCAGG + Intronic
1083013149 11:59423296-59423318 TTCCCAAATGGGAAAGGAGAGGG + Intergenic
1083321751 11:61851987-61852009 CTGCCAAATGGGATATGGGTAGG + Intronic
1083511092 11:63209982-63210004 CTCCCAAATGGGAAAAAAGCAGG + Intronic
1086631990 11:89031472-89031494 CTCCCAAACTGGCAATGTTGTGG + Intronic
1087468392 11:98540104-98540126 CTCCCCAAGGGGAAATATCGTGG + Intergenic
1088793483 11:113247538-113247560 CTCAGAGATGGGAAATGTGGAGG - Intronic
1090901834 11:131038705-131038727 CTCCAGAATGGGGAATGTGAAGG + Intergenic
1092037975 12:5357160-5357182 TTACCAAATGGGAAAAGTAGAGG + Intergenic
1095378840 12:41564741-41564763 CTCCCACATAGGCAGTGTGGGGG - Intronic
1097316027 12:58172506-58172528 CTCACAAAGGGACAATGTGGGGG + Intergenic
1098781887 12:74698100-74698122 ATCCCAGCTGGGAAATTTGGAGG - Intergenic
1099810942 12:87581462-87581484 TTCCCAAAAGGGAATTATGGTGG + Intergenic
1101558252 12:105831094-105831116 CTCCAAAATAGGAATTTTGGAGG - Intergenic
1102324753 12:111970313-111970335 CTCCAAAATGGAAAACATGGGGG + Intronic
1104294198 12:127496662-127496684 CTCCCCAAAGGGAAAGGTAGAGG + Intergenic
1106022788 13:25930858-25930880 CTCCCATGTGGGGGATGTGGAGG - Intronic
1106688643 13:32089887-32089909 TTTCCAAATGGCAAATCTGGTGG - Intronic
1107015835 13:35707000-35707022 CTCCCAAATGTGAACTCTGCAGG + Intergenic
1107022575 13:35766494-35766516 CTCCTGGATGGAAAATGTGGAGG + Intergenic
1107442976 13:40445088-40445110 CTCCCATATGGGAAATCGAGTGG + Intergenic
1107658955 13:42619578-42619600 CTCCTAAAGGGGAACTGTGGAGG - Intergenic
1107792086 13:44012983-44013005 TTCACAAGTGGAAAATGTGGAGG - Intergenic
1108958494 13:56189885-56189907 CTCTAAGATGGTAAATGTGGGGG - Intergenic
1111492725 13:89004021-89004043 CCCCAAAATGGGAAATGTTCTGG + Intergenic
1116006522 14:39297462-39297484 CTCCCAAATGGGAAATGTGGAGG - Intronic
1116409935 14:44609243-44609265 CAGCCAAATGGGCATTGTGGGGG - Intergenic
1117119448 14:52552582-52552604 CTAACCAATGGGAAACGTGGTGG + Intergenic
1118595489 14:67431774-67431796 CTCCCACATGGAAACTGGGGTGG + Intergenic
1120133814 14:80839955-80839977 CTCCCAAAGGGCAAATCTGATGG + Intronic
1120845958 14:89125334-89125356 CTCCCAAAAGAGGAAGGTGGAGG + Intronic
1121614568 14:95304534-95304556 CACCCAGCTGGGAGATGTGGGGG - Intronic
1121873182 14:97427723-97427745 TTCCCAAGTGGGAAATAAGGAGG - Intergenic
1121939415 14:98055594-98055616 CTCCCAAGCCGGAGATGTGGGGG + Intergenic
1126438657 15:48663478-48663500 ATCCAAGATGGGAAATCTGGCGG - Intergenic
1127902914 15:63354470-63354492 CTCCCCAAGGGGAGATTTGGGGG - Intronic
1127992721 15:64132724-64132746 CTCCCTAATGGGAGATATGTTGG - Intronic
1130420123 15:83737203-83737225 CTTAGAAATGGGAAGTGTGGGGG + Intronic
1130569738 15:85031186-85031208 CTGCCAAATAAGAAATGTGATGG - Intronic
1130816059 15:87434230-87434252 CTCCTAATTGGAAAATGTGATGG - Intergenic
1131115130 15:89790762-89790784 CTTCCAAATGGGAAAAGGGACGG + Intronic
1131122030 15:89828720-89828742 CTCCCACTTGGGCACTGTGGTGG - Intergenic
1131403364 15:92144165-92144187 GTCCCAACTGGGAACTGTGAAGG - Intronic
1131918960 15:97302063-97302085 CTCCTGGATGGGAAATGGGGTGG + Intergenic
1131919089 15:97303342-97303364 CTCCTGGATGGGAAATGGGGTGG - Intergenic
1132199977 15:99944628-99944650 ATCCCAACTGGGAAATGGGGTGG + Intergenic
1132674534 16:1116255-1116277 CCCCCACAAGGGACATGTGGGGG + Intergenic
1134056433 16:11173073-11173095 GGCCCAAATGGGAGGTGTGGTGG - Intronic
1138477616 16:57281420-57281442 GTCTGAAATGGGATATGTGGGGG - Intronic
1139984026 16:70882978-70883000 CTCACAAAGGAGAATTGTGGAGG + Intronic
1141585426 16:85030333-85030355 CACCCAAAAGAGAAATGCGGTGG + Intronic
1143305411 17:5942630-5942652 CTCCCACATGGCAAGTGTGTGGG + Intronic
1149329602 17:55567524-55567546 GCCCCAAGTGGGAAATGGGGTGG + Intergenic
1149909373 17:60553009-60553031 CTCCCCAAAGGGAAATCAGGTGG - Intergenic
1150124841 17:62629022-62629044 CTGCCAGATGGGAAAGGTGGGGG + Intronic
1150503228 17:65671267-65671289 CTCCCGAAGGGGAAATTGGGAGG + Intronic
1152026889 17:77815725-77815747 CTCCCAAGTGGTGAATGTAGAGG - Intergenic
1152668556 17:81586919-81586941 TTCCTCCATGGGAAATGTGGTGG - Intronic
1153933041 18:9895775-9895797 CTCCCAAATGGGAGATATGGGGG + Intergenic
1154198519 18:12283248-12283270 CTCCCTAATGGGCAACCTGGAGG - Intergenic
1156718918 18:40046249-40046271 TTCCCAAAAGGGAAAAGTGAGGG + Intergenic
1156956911 18:42977937-42977959 CTCCCAAAAGAGAAATCTTGTGG + Intronic
1159908917 18:74125126-74125148 CCCCCAAATGGTAAATTTGAAGG + Intronic
1160726255 19:619059-619081 CTCCCACATGGGCTCTGTGGTGG - Exonic
925245800 2:2381433-2381455 TTCCCAAATGGCAAAGGTGCAGG + Intergenic
925313083 2:2901668-2901690 CCAGCAAATGGGAAATGTGTAGG - Intergenic
925395457 2:3530129-3530151 CACCCGAATGGAAAATGTTGAGG + Intergenic
926786396 2:16522417-16522439 CAGCCAAGAGGGAAATGTGGGGG - Intergenic
927186490 2:20486064-20486086 CAGCCAAATGGGAAGTGAGGAGG + Intergenic
928188552 2:29138962-29138984 CACCCAAATAGGAAAAGAGGAGG - Intronic
929253477 2:39783317-39783339 CTCAGAAATGAGCAATGTGGGGG + Intergenic
930108031 2:47655350-47655372 CTCCGAAATGGCAAAGGTGAGGG + Intergenic
930586012 2:53267876-53267898 CACCCTAATGGCAAATATGGTGG - Intergenic
931756846 2:65382214-65382236 GTCCCACATGGGACCTGTGGAGG - Intronic
936615176 2:114041071-114041093 CTCCCACGTGGGAAACCTGGGGG - Intergenic
937240983 2:120462557-120462579 CCCCCAAAGGGAAAATCTGGAGG - Intergenic
937640860 2:124209536-124209558 CTCTAAAATGGAAAATGTGTGGG - Intronic
937981673 2:127619462-127619484 CACCCAAACTGGAAATCTGGGGG - Intronic
939311658 2:140486404-140486426 TTTCCAAATTTGAAATGTGGTGG - Intronic
943742534 2:191426112-191426134 CTTCCCAATGGGGAATGTGAAGG - Intergenic
944962050 2:204886209-204886231 CTACCGAATGGGATATGAGGAGG + Intronic
945155892 2:206836994-206837016 CTCACAAATATGAAATGTGGTGG - Intergenic
945179001 2:207072587-207072609 CTCACAAATGGTAAAACTGGGGG - Intergenic
945293681 2:208149689-208149711 CTCCAAAAAGGGAAATCTGTAGG + Intergenic
946177402 2:217929911-217929933 CTGCCAAATGGAGAATGGGGTGG - Intronic
1169177661 20:3532689-3532711 CTGACAAAGGGGAACTGTGGGGG + Intronic
1171214436 20:23342020-23342042 CTCCCAAGTGGGAGATGCTGAGG - Intergenic
1173119862 20:40278886-40278908 CTCCTAAATGGGAAGTCAGGAGG - Intergenic
1174542899 20:51303831-51303853 CACCCCAAGGGGGAATGTGGTGG + Intergenic
1175065364 20:56280090-56280112 CTGCCAACTGGTAAATGTGCAGG + Intergenic
1175428702 20:58888573-58888595 CTCCCAGGTGGGAGAGGTGGCGG - Intronic
1176293634 21:5059263-5059285 CTGCCATCTGTGAAATGTGGAGG - Intergenic
1179336646 21:40462838-40462860 GTGCCACATGGTAAATGTGGGGG + Intronic
1179863626 21:44204385-44204407 CTGCCATCTGTGAAATGTGGAGG + Intergenic
1180038172 21:45261382-45261404 CTCCCAGCTGGGAGATGTGAAGG - Intergenic
1180977478 22:19856215-19856237 CTCCCTCAAGGGAAAGGTGGGGG + Intergenic
1182778628 22:32849869-32849891 TTCCCAATTGTGAAATGAGGGGG + Intronic
1183365212 22:37403316-37403338 CTCCTAAATTGGGAAGGTGGTGG - Intronic
1183437679 22:37804917-37804939 CCCGCAAAGGGGAAATGTGCCGG + Intergenic
950515783 3:13464114-13464136 CTCCCAAATGGGATACCTGTCGG + Intergenic
950745282 3:15083011-15083033 CTCCAAAATGGGCAATGTGGTGG - Intronic
952179373 3:30901945-30901967 CTCCCAGATGGCTCATGTGGTGG - Intergenic
955789686 3:62575805-62575827 CTTCCGAATGGGAAAGCTGGTGG + Intronic
955869300 3:63419645-63419667 ATTGCAATTGGGAAATGTGGGGG - Intronic
957225211 3:77434313-77434335 GTTGCAAATGGGAAATTTGGGGG - Intronic
957531893 3:81451231-81451253 CTTCCAAATTGAGAATGTGGAGG - Intergenic
960492871 3:118338459-118338481 ATGGCAAATGTGAAATGTGGAGG + Intergenic
960956453 3:123034822-123034844 CTCTCATCTGGGAAATGAGGGGG + Intergenic
960964593 3:123096057-123096079 TTCCAAAATGGGGAATGGGGAGG - Intronic
961109668 3:124273205-124273227 CTCCAAGATGGGGAATGTGGGGG - Intronic
962374548 3:134849474-134849496 GTCAGAAATGGGAAATTTGGAGG + Intronic
963717329 3:148818793-148818815 CTCCAAAAAGGGAAAGGTAGAGG - Intronic
964776026 3:160278489-160278511 ATCCAAAAAGGGAAAAGTGGTGG - Intronic
966800725 3:183761534-183761556 CTCCCAATTGGGCAAAGAGGTGG - Exonic
969382118 4:6808873-6808895 CTACTAAATGGTACATGTGGAGG + Intronic
969711182 4:8845062-8845084 TTCCCAACTGGGACATGTGGAGG + Intergenic
970563323 4:17305104-17305126 CTCCAAAAGGGGAGAGGTGGGGG - Intergenic
971092997 4:23366740-23366762 CTCTCTAATGGGAAATGTTTGGG - Intergenic
973823532 4:54683876-54683898 CTCCCAGCTGGGCAATGTTGAGG + Intronic
974497100 4:62645985-62646007 CTGCCACATGGTGAATGTGGAGG - Intergenic
979735825 4:124082349-124082371 CTCCCTAATGCCAAATATGGGGG - Intergenic
980408483 4:132383526-132383548 GTCCCAAAAGGGTAATGTGGAGG + Intergenic
981996648 4:150982666-150982688 TTCCAGAAGGGGAAATGTGGTGG - Intronic
982092981 4:151896585-151896607 CTCCCATCTGTGACATGTGGTGG + Intergenic
982475856 4:155849724-155849746 CTCCAAATTAGGAAATATGGGGG - Intronic
985362207 4:189187440-189187462 CTCCCAAATAGGATATTGGGAGG + Intergenic
989785453 5:45322525-45322547 ATCCCAAATGAGAAATCTTGGGG + Intronic
990007847 5:50964006-50964028 CTCCTGACTGGGAAATGTGCGGG - Intergenic
991122313 5:63030881-63030903 TTCCCAAATGGATAATGTTGGGG + Intergenic
992076927 5:73200499-73200521 CTCAGAAATGGGATATGTGCTGG - Intergenic
992124880 5:73629465-73629487 CACCCAGACTGGAAATGTGGTGG - Intronic
995351012 5:111175661-111175683 CTTTCAAATGGGAGATGTGTTGG - Intergenic
999182538 5:149680412-149680434 CTGCCAAAAGGGAAATGGGCAGG - Intergenic
1007045435 6:38768930-38768952 CTGCCAATTGGCAAATTTGGGGG - Intronic
1008854829 6:56071090-56071112 CTCCCACCTGTGCAATGTGGTGG - Intronic
1009647228 6:66421474-66421496 CTCACAAATAGGCAATGTGAAGG + Intergenic
1011295477 6:85822460-85822482 CACCCAAATTGGAAATTAGGAGG - Intergenic
1012442042 6:99270024-99270046 GTCAGACATGGGAAATGTGGAGG - Intergenic
1014845717 6:126274410-126274432 ATCCCAAATGAGAAATCTAGTGG - Intergenic
1015854630 6:137610250-137610272 CTCCCAGCAGGGCAATGTGGAGG - Intergenic
1018076649 6:160222358-160222380 CACACACATGGGAAATGTGACGG + Intronic
1019778241 7:2925076-2925098 GTCCCAAAATGAAAATGTGGGGG - Intronic
1020381158 7:7547878-7547900 CTGGGAAATGGGACATGTGGTGG + Intergenic
1021174715 7:17437901-17437923 TTCCCAAGTGGGAATTATGGAGG + Intergenic
1023888825 7:44378423-44378445 CACCCAGATGGGAAATGTAGGGG + Intergenic
1027564891 7:79779416-79779438 CTCCAAAATGAGAAAAGTGAGGG - Intergenic
1028155914 7:87429201-87429223 ATCAGAAATGGGAAATGTGGGGG + Intronic
1029632655 7:101762790-101762812 CTCCCAAATAGAAATTGGGGGGG + Intergenic
1031250687 7:119376433-119376455 CTGCCAAATTGCAAATGTGTGGG + Intergenic
1035375076 7:158402298-158402320 TCCCCAAATTGGAAATCTGGGGG + Intronic
1036631949 8:10522064-10522086 CTCACACTTGGGAAATCTGGAGG - Intergenic
1038989687 8:32854485-32854507 CATCCAAATGGCAAATATGGAGG - Intergenic
1039216669 8:35279560-35279582 ATTCCAAATGTAAAATGTGGTGG + Intronic
1040091974 8:43408206-43408228 TGCCCAAATAGGAAAGGTGGTGG + Intergenic
1044517585 8:93157054-93157076 GTTCCAAATAGGAAATGGGGTGG + Intronic
1047587828 8:126293543-126293565 CTCCCAAACTGGAAAGGTGCAGG - Intergenic
1050271081 9:3945943-3945965 AGCCCAGGTGGGAAATGTGGGGG - Intronic
1050790023 9:9456793-9456815 CACCCAACTGGTAAATGTGGGGG + Intronic
1056495467 9:87150479-87150501 TTCCCAAAAGGGATGTGTGGGGG - Intronic
1056688110 9:88783496-88783518 CTCCCAAATAGGAGATTTGCTGG + Intergenic
1056815328 9:89796869-89796891 CTCCCACCAGGGAAATGTGTAGG - Intergenic
1058205420 9:102100054-102100076 CTCCCAAGTGGGATTTGGGGTGG + Intergenic
1058207068 9:102121599-102121621 CTCTGAAATGGGAAATGAAGTGG - Intergenic
1058929930 9:109709099-109709121 CTCTCAAATGGGAATACTGGGGG + Intronic
1061141946 9:128772386-128772408 CTTCCAAATGGGAAATTGGGCGG + Intronic
1062540393 9:137039404-137039426 GCCCCAAATGGGAGATGAGGCGG + Intergenic
1203567567 Un_KI270744v1:104752-104774 CTCAAATAGGGGAAATGTGGTGG - Intergenic
1185828503 X:3276000-3276022 CTGCCAAATGGGGAATGAGAAGG + Intronic
1186976756 X:14915916-14915938 TTCCCACATGTGAAATGGGGTGG + Intronic
1187102606 X:16210160-16210182 CTCCCAAAGAGGATATGTGTGGG + Intergenic
1189487651 X:41445529-41445551 CTCCCAAGTGGAAAATAAGGAGG - Intergenic
1189928367 X:45981741-45981763 CACAAAAATGGGAAACGTGGGGG - Intergenic
1194750780 X:97681996-97682018 CTCCCATATGTGAAATGTGGTGG - Intergenic
1195782403 X:108480164-108480186 CACCCAAATGAGGAATGTGTTGG + Intronic
1197808279 X:130417639-130417661 CTCCCATAGGGAAAATGGGGAGG + Intergenic
1198039261 X:132833690-132833712 CTCCCCAATGTGAAAAGTGATGG + Intronic
1202079871 Y:21073326-21073348 CTCCCATATGGGCAAAGTTGAGG - Intergenic