ID: 1116008471

View in Genome Browser
Species Human (GRCh38)
Location 14:39323194-39323216
Sequence TAAGTGAAGCAAAATGAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 308
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 282}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116008471_1116008477 18 Left 1116008471 14:39323194-39323216 CCACCCTCATTTTGCTTCACTTA 0: 1
1: 0
2: 1
3: 24
4: 282
Right 1116008477 14:39323235-39323257 TCCCAGTCCCCCCAGTAGATTGG 0: 1
1: 0
2: 3
3: 148
4: 3042
1116008471_1116008479 19 Left 1116008471 14:39323194-39323216 CCACCCTCATTTTGCTTCACTTA 0: 1
1: 0
2: 1
3: 24
4: 282
Right 1116008479 14:39323236-39323258 CCCAGTCCCCCCAGTAGATTGGG 0: 1
1: 0
2: 0
3: 5
4: 160
1116008471_1116008486 30 Left 1116008471 14:39323194-39323216 CCACCCTCATTTTGCTTCACTTA 0: 1
1: 0
2: 1
3: 24
4: 282
Right 1116008486 14:39323247-39323269 CAGTAGATTGGGCCACAGCCTGG 0: 1
1: 0
2: 3
3: 14
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116008471 Original CRISPR TAAGTGAAGCAAAATGAGGG TGG (reversed) Intronic
900851047 1:5143344-5143366 TAAGAGAAGCAGGAGGAGGGAGG + Intergenic
900979910 1:6040491-6040513 GAAGAAAAGCAAAATAAGGGAGG - Intronic
901948773 1:12724917-12724939 TCAGGGAAGCAACATGAGGCAGG + Intronic
902217999 1:14946740-14946762 TAAATGCAGCAAAATGAGTAAGG - Intronic
904888857 1:33762883-33762905 TAAATGCAGCAAAATGTGGAAGG - Intronic
905361445 1:37423523-37423545 TGAGTGAAGCAAAATTCAGGAGG + Intergenic
907107622 1:51898431-51898453 TAAGTGAAGAAGAATGAAAGGGG + Intergenic
909798731 1:79778652-79778674 TAAGTGAATCAAAATATGGAGGG - Intergenic
910208682 1:84772957-84772979 TACCTGAAGCAAAAAGAGGCAGG + Intergenic
910300817 1:85705555-85705577 TAACTGAAGCATAGTGAGTGAGG - Intronic
910510081 1:87993650-87993672 GAAGTTAAGAAAAATGAGGTTGG + Intergenic
911743858 1:101417533-101417555 TAATTAAAGCCAAATGAGGTGGG + Intergenic
911812421 1:102299976-102299998 TAAGTTAAGCGAAATAAGAGAGG + Intergenic
913288693 1:117252223-117252245 TAACTGACACAAAATTAGGGTGG - Intergenic
915506242 1:156358178-156358200 TAAATGAAGCAACAGGTGGGGGG - Intronic
915790669 1:158666852-158666874 TAGGAGAAGCATAATGAGGTTGG + Intronic
916195714 1:162220291-162220313 TAGCTGAATCAAAATGAGGGAGG - Intronic
916663845 1:166947826-166947848 CAAGTGAAGCAAAAATAGTGAGG + Intronic
916681998 1:167113401-167113423 AAAGTGAAGCCACATCAGGGTGG + Intronic
917418329 1:174834856-174834878 TAAGTGCTGGAAAATGAGGTTGG + Intronic
917745957 1:178007399-178007421 CAAGCAGAGCAAAATGAGGGAGG + Intergenic
918031193 1:180813194-180813216 AAAGTGAAGCTAAGTGTGGGGGG - Intronic
918346672 1:183613519-183613541 TCAGTGAAGGGAAATAAGGGTGG - Intergenic
918347604 1:183619249-183619271 TCAGTGAAGGGAAATAAGGGTGG - Intergenic
920629528 1:207638113-207638135 TCAGTTAAGCAAAAAGAAGGGGG - Intronic
921307541 1:213812179-213812201 GAAGTGAAGGAAAAGGAGGGAGG + Intergenic
922049887 1:221978609-221978631 TCAGTGAAGCGAGATAAGGGTGG + Intergenic
922268041 1:224005765-224005787 TAAGTGAAAGAATATGAGGCTGG + Intergenic
923724912 1:236497358-236497380 TAAATGAAGCAGAAAGAGGCCGG - Intergenic
924827946 1:247561853-247561875 TGACTGAACCAAACTGAGGGCGG + Intronic
924901346 1:248404439-248404461 TAAAAAAAGTAAAATGAGGGAGG + Intergenic
1063286119 10:4690482-4690504 AAAGGGAAGAAAAATGAGGCAGG + Intergenic
1064573863 10:16724408-16724430 AAACTGGACCAAAATGAGGGAGG + Intronic
1064839393 10:19573518-19573540 GAAGAGAAAGAAAATGAGGGAGG - Intronic
1067949473 10:50716563-50716585 TAAGTGTACAAAAGTGAGGGTGG + Intergenic
1068611859 10:59069177-59069199 CAAGTGAAGACAAGTGAGGGAGG - Intergenic
1068803751 10:61171660-61171682 AAACTGAAGAAAAATGAGGAGGG + Intergenic
1069332083 10:67304895-67304917 TAAGTCAAGCAGAAGGAGTGAGG + Intronic
1070884782 10:79881581-79881603 TAAGTGTACAAAACTGAGGGTGG + Intergenic
1075142786 10:119854572-119854594 TAAATAAAACAAAATGAAGGTGG + Intronic
1082283068 11:50291373-50291395 TAAGTGAAAGAATATGAGGCCGG - Intergenic
1082759105 11:57109246-57109268 TAAGAGAAGGGAAATGAGTGAGG - Intergenic
1083549362 11:63574799-63574821 AAAATAAAGCAAAACGAGGGAGG - Exonic
1084568534 11:69945241-69945263 CAAGGGAAGGGAAATGAGGGAGG + Intergenic
1084848046 11:71916263-71916285 AAAGAGAAACAAAATCAGGGGGG + Intronic
1084959857 11:72710697-72710719 GAAGTCAAGCAAAATGATGGGGG - Intronic
1085586181 11:77708808-77708830 TAGCTGAAGCAGAATGAGTGGGG - Intronic
1086269481 11:85044101-85044123 TAAGTGAAACAAGATGAATGGGG - Intronic
1087193251 11:95278774-95278796 TGAGAGAAGCAGAATGAGGAGGG + Intergenic
1087792727 11:102424071-102424093 TAAAAGCAGCAAATTGAGGGAGG + Intronic
1088224619 11:107606078-107606100 TACATGAAACAAAATGAGAGAGG - Intronic
1089134657 11:116239426-116239448 TAAGTGAAGAAGAAGGAGGTGGG - Intergenic
1090605693 11:128421089-128421111 TAAGTGAAGTAAACTGAGATTGG - Intergenic
1091817585 12:3451743-3451765 TAAGTGAATCAACATGTAGGTGG - Intronic
1092564879 12:9654192-9654214 TAGGTGAAGCAAAGTGAAGATGG + Intergenic
1092679682 12:10964990-10965012 TAAGTGAAGAAAAATAAAGTTGG + Intronic
1092684812 12:11030973-11030995 TAAGTGAAGAAAAATAAGGTTGG + Exonic
1092687121 12:11061932-11061954 TAAGTGAAGAAAAATAAGGTTGG + Exonic
1092689492 12:11091867-11091889 TAAGTGAAGAAAAATAAAGTTGG + Exonic
1093728344 12:22541539-22541561 GAAGTGAAGGAAAATGCGTGTGG - Intronic
1095264407 12:40136827-40136849 TATGTGAAGCAAAATAAGCCAGG - Intergenic
1097625794 12:61998777-61998799 TAATTGAAGAAAAACAAGGGAGG + Intronic
1097632752 12:62083523-62083545 AAAGTAAAACAAAATAAGGGTGG + Intronic
1098058263 12:66532542-66532564 CAAGTGCAGCATAATGAGGTAGG - Intronic
1099278431 12:80608779-80608801 AAAGTGAAGCCAATTGAGTGGGG + Intronic
1099442418 12:82714640-82714662 GAAGCGAAGGAAAATGAGGGAGG - Intronic
1100607291 12:96162173-96162195 CATGTTAGGCAAAATGAGGGAGG + Intergenic
1100788571 12:98105630-98105652 TAGCTCACGCAAAATGAGGGTGG - Intergenic
1101989069 12:109469613-109469635 TACGTGAAGCTGAATGTGGGTGG - Exonic
1105897685 13:24730956-24730978 GAAGTGGTACAAAATGAGGGTGG + Intergenic
1106903506 13:34380387-34380409 GATGTGATGCAAAATGAAGGAGG + Intergenic
1107289247 13:38833860-38833882 TAGGTGAAGCCAAAGGAGTGTGG - Intronic
1107309216 13:39058944-39058966 TAACTGAAGGAAAAGGAAGGAGG - Intergenic
1108256686 13:48618065-48618087 TAAGAGAAGGAGAATGAAGGGGG + Intergenic
1109127146 13:58531620-58531642 TAAGTGAGGCAAGATGAGCAGGG + Intergenic
1110119118 13:71861057-71861079 GCAGTGAGGCAAAAAGAGGGTGG + Intronic
1110355735 13:74564842-74564864 AAAGTGAAGCAAAATGTGTGTGG - Intergenic
1110816576 13:79866989-79867011 CAAGTGAAACAAAATGAAGGAGG + Intergenic
1112352759 13:98650353-98650375 TAAGAGAAGCAAAGACAGGGTGG + Intergenic
1113318687 13:109211156-109211178 TAAAGGAAGAAAAATGGGGGTGG - Intergenic
1115241823 14:31257433-31257455 TATGGGAAGCAAAGAGAGGGTGG + Intergenic
1115895763 14:38085023-38085045 TATGTTAGGCAAAAAGAGGGTGG - Intergenic
1116008471 14:39323194-39323216 TAAGTGAAGCAAAATGAGGGTGG - Intronic
1116035189 14:39618935-39618957 AAAAAGAAGCAAAATGAGGTCGG - Intergenic
1117327813 14:54684945-54684967 TAAGTGTAGCCAGAGGAGGGTGG + Intronic
1118194945 14:63616470-63616492 TAAGGCAAGAAAAATGAGGCAGG + Intronic
1118840265 14:69504617-69504639 TAGAAGAAGAAAAATGAGGGTGG - Intronic
1119370286 14:74134632-74134654 TAAGAAAAGGAAAATGGGGGAGG - Intronic
1120096365 14:80393091-80393113 TAAAGGAAGTGAAATGAGGGTGG + Intergenic
1120388674 14:83878372-83878394 TCAGTGTTGCAAACTGAGGGAGG - Intergenic
1120502593 14:85315268-85315290 AAAGTAAAGCAAAAAGTGGGTGG - Intergenic
1121233911 14:92378752-92378774 AAAGTGAAACAAAATGAGCCAGG + Intronic
1121895009 14:97638667-97638689 TAGGGGAAGCAAACTGAGTGTGG + Intergenic
1122188349 14:100019560-100019582 AAAGTGCAGAAAAATGAGGCGGG - Intronic
1126569715 15:50137514-50137536 TAACTGAAGCAAAATGCTGCTGG - Intronic
1126852942 15:52809311-52809333 TATGTCAAGCAAAATGTTGGGGG - Intergenic
1127470536 15:59286266-59286288 TAAGTCATGCAAAATGCTGGAGG + Intronic
1127507116 15:59608181-59608203 TAAGTGAAATAGAATAAGGGGGG - Intronic
1128909723 15:71502339-71502361 AAAGTTAATCAAAATTAGGGTGG + Intronic
1129155897 15:73717715-73717737 CAAGTGAAGAAAACTTAGGGTGG + Intergenic
1129644263 15:77415980-77416002 TAAGTGTAGCTAATTGAGAGGGG - Intronic
1134595365 16:15491617-15491639 TGGGTGGAGCAAAATGAGGAAGG - Intronic
1135528745 16:23234427-23234449 TAATTGAAATAAAATGAGGTAGG + Intergenic
1135615252 16:23905789-23905811 TATGTGAAGAAAAATGGGGTGGG - Intronic
1137007724 16:35293961-35293983 TAATTTAAGAAAAATGAGAGGGG + Intergenic
1137583122 16:49646474-49646496 TCAGTGAAATAAGATGAGGGAGG - Intronic
1137908830 16:52354600-52354622 CAAGTGCAGCAGAAAGAGGGAGG - Intergenic
1138070077 16:53984237-53984259 TAAGAAAAGCAAGGTGAGGGTGG - Intronic
1141053841 16:80797809-80797831 TAATTGAAACAAGATGATGGTGG - Intronic
1141249196 16:82339477-82339499 GAAGGGAAACAAAAAGAGGGAGG - Intergenic
1141408439 16:83815143-83815165 TCAATGAATGAAAATGAGGGAGG + Exonic
1141856210 16:86683052-86683074 TGAATGAAGCAAAGAGAGGGAGG + Intergenic
1144513261 17:15895792-15895814 TTAGGGAAGCAAAGAGAGGGAGG + Intergenic
1148591410 17:48818944-48818966 AAACTGAAGCAGAATGATGGAGG + Intergenic
1150691949 17:67374823-67374845 TAAGTCATGCACACTGAGGGCGG - Intergenic
1151196650 17:72436403-72436425 GAAATGATGCAAGATGAGGGAGG - Intergenic
1152599657 17:81255682-81255704 TTTTTGAAGCCAAATGAGGGAGG - Intronic
1155210504 18:23596487-23596509 GAAGTGAAACATAATGAGGAAGG - Intergenic
1155836219 18:30588218-30588240 TAAGTGGAGCAGAATGAGTGAGG + Intergenic
1155989384 18:32263813-32263835 TAAATGAAACAATATGAGAGTGG + Intronic
1156040698 18:32817963-32817985 TCAAAGAAGCAAAATGTGGGGGG + Intergenic
1156595413 18:38542730-38542752 CACATGAAGCAGAATGAGGGAGG - Intergenic
1156621409 18:38856205-38856227 TAAGTGAACCAAAGGTAGGGAGG + Intergenic
1157387885 18:47274862-47274884 TAACTGGAGGAAAATGAGGGAGG + Intergenic
1157594485 18:48855924-48855946 AAAGTGAAGCCCAATGAGTGTGG + Intronic
1158495191 18:57948987-57949009 TGAGGGAAGAAAAATGATGGAGG - Intergenic
1161918313 19:7247259-7247281 TAAGTGGAGTAAAATGGGTGTGG - Intronic
1164682998 19:30148405-30148427 TAAAATGAGCAAAATGAGGGTGG - Intergenic
1166536664 19:43578933-43578955 AAAGAGAAGGAAAATGTGGGAGG + Intronic
925507899 2:4589309-4589331 TAAGTGTAGTCAAATGAGGTAGG - Intergenic
925936218 2:8764123-8764145 TAAGTGAAGTAAAACAAGAGTGG + Intronic
926779862 2:16460535-16460557 TAAGTGAAGCCAGATAAAGGGGG + Intergenic
926974672 2:18502566-18502588 TAATAGAAGCAAAATGTGGTGGG + Intergenic
927273380 2:21238736-21238758 AAAGTGAAGCAAAAAGTGAGGGG - Intergenic
928237770 2:29559695-29559717 TAAATGAAGAGTAATGAGGGTGG + Intronic
929000454 2:37343219-37343241 TAAATGAAACAAAATGTGAGAGG - Intergenic
929431909 2:41894223-41894245 AAAGTGAATCATAATTAGGGTGG + Intergenic
930944402 2:57055303-57055325 TATGTGAAGCAAAATAAGCCAGG - Intergenic
932062148 2:68513878-68513900 TAAATGAAAAAAAATTAGGGTGG - Intronic
935306070 2:101737818-101737840 TAAGTGAGGGAGAAAGAGGGGGG - Intronic
935499139 2:103816893-103816915 AAAGTTTAGCAAAATGAGTGTGG + Intergenic
935504342 2:103881715-103881737 TAAGTCAAGCAAAATCAAGCAGG + Intergenic
938272584 2:129987329-129987351 TAAGTGCAGCAAAATTATGAAGG - Intergenic
938443651 2:131358780-131358802 TAAGTGCAGCAAAATTATGAAGG + Intergenic
938685583 2:133734523-133734545 GAATGGAAGCAAAATTAGGGTGG + Intergenic
939477052 2:142700550-142700572 GAAGTGTAGCAAAAAGAAGGAGG + Intergenic
940000657 2:148963799-148963821 CAAGAGATGCAAAATGATGGGGG - Intronic
941158490 2:162007981-162008003 TAAGCGATGGAAGATGAGGGAGG - Intronic
941485815 2:166080851-166080873 TAACTGAAAGAAAAAGAGGGAGG + Intronic
942383578 2:175418901-175418923 ATAGTGCAGCAAAATGATGGAGG - Intergenic
942916146 2:181309623-181309645 TAAGTGAAGCAGAATGATCTAGG + Intergenic
943765135 2:191652660-191652682 TAAGTGAAGGAAAAAGATTGAGG - Intergenic
944029414 2:195216147-195216169 TAAGTCAAACAAAATGTTGGAGG + Intergenic
944768937 2:202893814-202893836 TAAAAGGAGCAAATTGAGGGAGG - Intronic
945702394 2:213188404-213188426 TCAGAGAAGCAAAGTGAGGAGGG - Intergenic
945703181 2:213197532-213197554 ACAGGGAAGCAAAATGAGGAAGG + Intergenic
946745107 2:222837662-222837684 TAACTAAAGCACAGTGAGGGTGG - Intergenic
947206031 2:227661971-227661993 TAATGGAAGAAAAAAGAGGGTGG - Intergenic
948648423 2:239423899-239423921 TAAGTCAAGAAAAAGGAGAGAGG + Intergenic
1168857705 20:1020353-1020375 TGGATGAAGCAGAATGAGGGAGG + Intergenic
1169002626 20:2178962-2178984 TAAGTGGAGCACAGTGAAGGGGG + Intergenic
1171271786 20:23823825-23823847 TATGAGAAGCAAAAGGAAGGAGG + Exonic
1171437581 20:25135216-25135238 TAAATGATGCAAAGTGTGGGAGG - Intergenic
1174238106 20:49110846-49110868 TAAGTGAAGGACAAGGATGGAGG + Intergenic
1179537941 21:42064231-42064253 TGAGTCAAGCAGAATGTGGGTGG + Intronic
1180560498 22:16611095-16611117 GCAGTGAAGGAAAATGAAGGAGG - Intergenic
1182910190 22:33977587-33977609 AAAGTGAAGCAGAATGAAGATGG - Intergenic
949351601 3:3128945-3128967 TAAGTGAAGGAAAACAAAGGGGG - Intronic
950088781 3:10280033-10280055 AAAGTGAAACAAAAGGAGGCTGG - Exonic
951974354 3:28487828-28487850 TAGGTGAAGAAAAAAAAGGGGGG - Intronic
952086605 3:29829572-29829594 TAGCTGAAGCAGAATGGGGGAGG + Intronic
952337826 3:32420413-32420435 AAAGTGAAGCCCAATGAGGTGGG + Intronic
952534242 3:34293677-34293699 TTAGTGAAGGAAAAGAAGGGAGG - Intergenic
955793519 3:62611631-62611653 TAAATGAACCAGAATGAGAGGGG - Intronic
956952264 3:74296253-74296275 GAGGAGAAGAAAAATGAGGGAGG + Intronic
958843418 3:99236537-99236559 CAAATGAAGCAAACTAAGGGAGG + Intergenic
960464921 3:117985849-117985871 TAAGGGCAGCAAAGGGAGGGAGG + Intergenic
960949821 3:122992127-122992149 AAAATGAAACACAATGAGGGTGG - Intronic
967579800 3:191138591-191138613 TAAGTGAAGCAAAGAGAAAGTGG + Intergenic
968247631 3:197169189-197169211 TCAATGAATCAAAGTGAGGGAGG - Intronic
968289498 3:197527632-197527654 TGGCTGAAGCAGAATGAGGGGGG - Intronic
971897040 4:32610296-32610318 TAAGTGAAGCTAAAAGGTGGAGG - Intergenic
975108118 4:70592185-70592207 AAAGTGAAGCAAAATGGCGAGGG - Intergenic
975334250 4:73157378-73157400 AAACTCAAGCAAAATGAGAGTGG + Intronic
976456026 4:85247572-85247594 CAAGCAGAGCAAAATGAGGGAGG - Intergenic
977413096 4:96693211-96693233 TAAGTCAACCAAGATGAGAGTGG - Intergenic
977455329 4:97252510-97252532 GAAGGGAAGAAAAAGGAGGGTGG - Intronic
979336033 4:119463957-119463979 TAAGTGAAAGAATATGAGGCTGG + Intergenic
979605401 4:122633127-122633149 TAGGTAAAGGAAAATGTGGGTGG - Intergenic
979914980 4:126420614-126420636 TAAGTGTCGGAAAAGGAGGGTGG + Intergenic
980258834 4:130421026-130421048 TAGGTTAAGCAAAATAAGAGAGG - Intergenic
980463252 4:133145980-133146002 TAAGTGCAGCAGAAACAGGGGGG - Intergenic
982274861 4:153628319-153628341 AAAGAGAAGAAAAATGAGGGAGG - Intronic
982665230 4:158252881-158252903 TAAGTGGAGCAAGATGAGGTTGG - Intronic
982988289 4:162238386-162238408 CATGAGAAGCCAAATGAGGGAGG - Intergenic
983167004 4:164490293-164490315 TCAGTGCTACAAAATGAGGGTGG - Intergenic
984287734 4:177755009-177755031 TAAGTGAAACAAAATGAAAGTGG + Intronic
988517143 5:31914950-31914972 TAAGTTCAGCAAAATGTAGGGGG + Intronic
988677269 5:33445336-33445358 GAAGAGAAGCAAAAGGAAGGAGG + Exonic
989429746 5:41338939-41338961 TAAAAGAACCAGAATGAGGGCGG - Intronic
990241850 5:53823890-53823912 TAGCTTAAGCAAAATGTGGGGGG - Intergenic
992676943 5:79114447-79114469 GAAGAGAATGAAAATGAGGGAGG + Intronic
992735792 5:79719242-79719264 TAAGTGAAAAAATATGAGGGAGG - Intronic
993237245 5:85328328-85328350 TAATTGAAGTGAAATGAGGATGG + Intergenic
996168267 5:120254052-120254074 TAATTGAAGCATAATAATGGTGG + Intergenic
999852830 5:155561286-155561308 TAAGTAACCCAAAATGATGGTGG + Intergenic
1000324722 5:160163587-160163609 AGAGTGAAGGAAAATGATGGCGG + Intergenic
1000797413 5:165682335-165682357 TAAAAAAAGAAAAATGAGGGGGG + Intergenic
1001178766 5:169498545-169498567 TACATGATGCAAAATGATGGAGG + Intergenic
1001213826 5:169836570-169836592 GAAATAAAGCAAAATGAGGATGG - Intronic
1001705723 5:173739995-173740017 TGACTAAAGCAGAATGAGGGAGG + Intergenic
1002941245 6:1718268-1718290 TCTGTGCTGCAAAATGAGGGAGG - Intronic
1004611934 6:17250237-17250259 GAAGTGGAGCATAATGAGGGAGG + Intergenic
1004649318 6:17593356-17593378 AAAGTTAAGCAAAATGGAGGTGG - Intergenic
1005214448 6:23508799-23508821 TAAGTGAGGGAAGGTGAGGGAGG - Intergenic
1005460547 6:26065498-26065520 CAAGTGAAGTAAAATGACTGAGG + Intergenic
1005509224 6:26497398-26497420 TAAGAGAAGTGAAATGAGGAAGG + Intergenic
1006061025 6:31419412-31419434 TAGTTGCACCAAAATGAGGGGGG - Intergenic
1008380110 6:50831705-50831727 TGAGTTAAGCAACATGATGGTGG - Intronic
1009168977 6:60375675-60375697 TAAGAGAAGCAAGATGTGAGGGG + Intergenic
1009583714 6:65569292-65569314 TCAGTGAAGGGAAATAAGGGTGG - Intronic
1009592867 6:65695551-65695573 TCAGTGAAGGAAAAAGAGAGAGG + Intronic
1009948994 6:70373754-70373776 TATATGAAGCAAAATGAAGGTGG - Intergenic
1010933685 6:81834956-81834978 TAAAGGAAGAAGAATGAGGGAGG + Intergenic
1012120729 6:95363509-95363531 TAAGTGAGGCAGAATAAGGTAGG + Intergenic
1012517239 6:100076655-100076677 GAAATGAAGCAAAATTAGGGTGG - Intergenic
1012974970 6:105770669-105770691 TACGTGAAGCAAAATGAGTGAGG + Intergenic
1013668823 6:112376151-112376173 GAGGAGAAGGAAAATGAGGGAGG + Intergenic
1014472666 6:121835473-121835495 TATGTGAAGAAAGTTGAGGGTGG + Intergenic
1015590608 6:134819331-134819353 GAGATGAAGAAAAATGAGGGGGG - Intergenic
1017340169 6:153311881-153311903 TTAGGGAATAAAAATGAGGGAGG - Intergenic
1017795836 6:157843533-157843555 TAGGTGGAGGAAAAGGAGGGTGG + Intronic
1020343084 7:7133791-7133813 GAAGTGAAGTAAAAAGATGGAGG + Intergenic
1021186808 7:17574562-17574584 TAAGTGAAGCCAAATGAGTTAGG - Intergenic
1022598197 7:31732412-31732434 TGAGTAAAGCACAATGTGGGTGG + Intergenic
1022854576 7:34302542-34302564 TAAGTGAGGCAAAGAGAGGCTGG + Intergenic
1022920826 7:35012311-35012333 TGAATGAAGCAGAATGAGGTAGG - Intronic
1024067769 7:45755912-45755934 TAAGTGAAAGAATATGAGGCTGG - Intergenic
1024623824 7:51187660-51187682 TAATTGATGAGAAATGAGGGAGG - Intronic
1026434499 7:70383723-70383745 TAAGACAAGCAAAAATAGGGTGG + Intronic
1027531780 7:79343467-79343489 TAAGTGGAGGAATATGAAGGAGG + Intronic
1032708461 7:134442241-134442263 TCAGTGATGCAAAAGGAGTGAGG - Intergenic
1032730188 7:134633785-134633807 GAAGTGAAGAAAAAGTAGGGGGG - Intergenic
1032872009 7:135996175-135996197 TAACTGGAGCAATATGAGGTAGG + Intergenic
1034087795 7:148335967-148335989 GAAGGGAAGGAGAATGAGGGAGG - Intronic
1034156029 7:148956763-148956785 TAAGAGTAGCACAATGGGGGAGG - Intergenic
1034279201 7:149839874-149839896 AAAGAGAAGCAAAATGTAGGGGG + Intronic
1034590794 7:152137345-152137367 TGAGTGAGGAAAAATGAAGGAGG - Intronic
1037126475 8:15357176-15357198 TAATTGAAGCAATATGAGTCTGG - Intergenic
1037218102 8:16483060-16483082 TACTTGAAGCATAATGTGGGTGG - Intronic
1037532375 8:19790543-19790565 TAAGTGGAACCAAGTGAGGGGGG + Intergenic
1038138197 8:24813721-24813743 TAAGTGGAGCAAGATGCTGGAGG - Intergenic
1038248934 8:25884500-25884522 TAAGGGAAGGAGAGTGAGGGAGG - Intronic
1039021959 8:33217989-33218011 TAAGTGAAGCTAAATTATGTAGG - Intergenic
1039266729 8:35832719-35832741 GAAGTGCAGTAAAATGAGGTAGG - Intergenic
1039355236 8:36808205-36808227 TAAGTGAAGAAAGATCAGAGGGG - Intronic
1040818023 8:51529373-51529395 TAAGTCAAGTAAGATGATGGTGG - Intronic
1044307047 8:90649897-90649919 TAAGTGAAGGAAAGGGATGGTGG + Intronic
1045051258 8:98327986-98328008 TAAGTGAAGAAATATGTGTGTGG - Intergenic
1045784618 8:105905621-105905643 AAACAGAAGCAAAATGAGGAAGG + Intergenic
1045923210 8:107556887-107556909 TAAGTGAGGCAGAATAAGGTAGG - Intergenic
1047096150 8:121628242-121628264 AAAATGAGGCAAAATGAGGGTGG - Intronic
1047360573 8:124165141-124165163 TGAGTGAAGAAAAATAAGGCGGG + Intergenic
1047616740 8:126568836-126568858 CAAGAGAAGCAAAAAGAGGGTGG + Intergenic
1047830976 8:128629325-128629347 GAAGTGAAACAGAATGAGTGTGG - Intergenic
1049372398 8:142274067-142274089 TAAGTCCAGCAAGGTGAGGGTGG - Intronic
1050004568 9:1116644-1116666 AAAATGAAGAAAAATGAAGGAGG - Intergenic
1050284627 9:4088460-4088482 TAAGATAAGGAAAATAAGGGAGG - Intronic
1050740531 9:8814372-8814394 TAAGTGAAGGAAACAGAGGAGGG + Intronic
1051516422 9:17935161-17935183 TAAGTCAAGTGAAATGAGGATGG - Intergenic
1051653827 9:19358346-19358368 TAACTGAAGCTAGATGATGGGGG - Intronic
1051729051 9:20120048-20120070 CAAATGAAGGAAAATGTGGGTGG - Intergenic
1051799961 9:20921486-20921508 TAAGTGAAACAAATTCAAGGAGG - Intronic
1052423401 9:28272978-28273000 TAAGTGACTCAAAATGAGCTGGG - Intronic
1056261596 9:84854319-84854341 GAAGTGAAACAAAAAGAGGTAGG - Intronic
1056839154 9:89984219-89984241 GAAGGGAAACAAAATCAGGGTGG - Intergenic
1057974092 9:99585652-99585674 TAAGTCAAGAAAACTGAGGATGG + Intergenic
1058150409 9:101457465-101457487 TAAATTAAGAAAAATGAGAGAGG - Intergenic
1058170572 9:101675991-101676013 TAAGACAAGAAAAATCAGGGGGG - Intronic
1058273768 9:103011286-103011308 AAAGTTAAACAAAATGAAGGGGG - Intronic
1058448085 9:105071463-105071485 TAAGTGAAGAAAAATGAGATGGG - Intergenic
1059108723 9:111534579-111534601 TCAGTGAAGGAAAATGAGGAAGG + Intronic
1059545704 9:115174752-115174774 TCAGTGAAGGGAAATAAGGGTGG + Intronic
1060083643 9:120676994-120677016 GAAGTGAAGTGAAATGAGGAAGG - Intronic
1060381534 9:123179022-123179044 GAAGTGAAGAAAGATGAGGCCGG - Exonic
1186621064 X:11240746-11240768 TAATTAAAGCAAAATGAGGCCGG + Intronic
1187265998 X:17734250-17734272 TAATTCATGCAAAATGAAGGAGG + Exonic
1187627356 X:21130851-21130873 TTACTGAAGCAGAATCAGGGTGG - Intergenic
1188216008 X:27477790-27477812 TAAGTAATGCGAAATGAGAGGGG + Intergenic
1188331266 X:28874322-28874344 TATGTGAATAAAAATGATGGTGG - Intronic
1188394300 X:29661674-29661696 TAAGAGAAGCAAGTTTAGGGTGG - Intronic
1189530429 X:41875615-41875637 TAAATGAAGCATAATCAGGGAGG + Intronic
1190853004 X:54264952-54264974 TAAGTAAAGCCAAATGAGCAAGG + Intronic
1193428585 X:81371682-81371704 TAATAGAAGCAAAATAAAGGAGG + Intergenic
1193492307 X:82165186-82165208 ATATAGAAGCAAAATGAGGGAGG + Intergenic
1193582197 X:83279635-83279657 CAAGTGAAGGAAAATGAGAAAGG + Intergenic
1194088504 X:89558137-89558159 TAAGTGAAGTAACACGGGGGTGG + Intergenic
1194379121 X:93173132-93173154 TAAGTTAAGCAAAATAAGCCAGG + Intergenic
1195998134 X:110751996-110752018 TAAGTTAAGCAAAATAAGTCAGG + Intronic
1196341229 X:114601372-114601394 TCAGTGAAGGGAGATGAGGGTGG + Intronic
1196342082 X:114606893-114606915 TCAGTGAAGGGAGATGAGGGTGG + Intronic
1197242305 X:124133090-124133112 GAAGTGAAGCCAAATGAAGCAGG - Intronic
1198198585 X:134390827-134390849 TAAGTTAAAAAAAATGAGGCAGG - Intronic
1198285789 X:135190180-135190202 TTAATGAAGCAAATTGAAGGAGG + Intergenic
1198435786 X:136615712-136615734 TAAGAGAATTACAATGAGGGAGG - Intergenic
1199466795 X:148147139-148147161 TAAGTGCAGAGAAGTGAGGGAGG - Intergenic
1199852553 X:151736106-151736128 TGAGTGAAGGAGAATGAGGCTGG - Intergenic
1200441180 Y:3214185-3214207 TAAGTGAAGTAACACGGGGGTGG + Intergenic