ID: 1116013426

View in Genome Browser
Species Human (GRCh38)
Location 14:39378000-39378022
Sequence CTGGAGCCCCTTGGAAAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 249
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 224}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116013426 Original CRISPR CTGGAGCCCCTTGGAAAAAC TGG (reversed) Intronic
901129639 1:6954260-6954282 CAGGTGCCCCGTGGAAAGACTGG + Intronic
902816906 1:18921787-18921809 GTGGAAGCCCTTGGAACAACAGG - Intronic
906147317 1:43567700-43567722 CTGGAGCCTCTTGGAGACCCAGG - Intronic
907212102 1:52832703-52832725 CTGGACTCCTTGGGAAAAACAGG - Intergenic
907865541 1:58396236-58396258 CTGGAGCCCCTGGGAATGGCTGG - Intronic
908761786 1:67519455-67519477 CCAAAACCCCTTGGAAAAACTGG + Intergenic
909179150 1:72398792-72398814 GTGCAGCCACTTGGAGAAACAGG - Intergenic
911161872 1:94689379-94689401 CTGGAGCCCTTTAGAAAAATGGG + Intergenic
913006959 1:114643074-114643096 CTGGAGACACTTAGAAAAAGAGG + Intronic
916623851 1:166532145-166532167 ATAAAGCCCCTTGGAAAAACTGG + Intergenic
918511255 1:185316666-185316688 CTGGAGCCCCTTTGCTACACTGG - Intronic
919855569 1:201703999-201704021 CTGGAGCCTCTTGGAAACTTTGG + Intronic
919920566 1:202164375-202164397 CGGGAGCCCCTGGGAAGAAAAGG - Intergenic
920401464 1:205679286-205679308 CTCTGGCCCCTTGGAAAAAGAGG + Intronic
920612582 1:207455846-207455868 CTGGAGCCCCATGAAATACCAGG + Intronic
921077158 1:211709077-211709099 CTGGACCCCTTGGGAAAAGCAGG + Intergenic
921711135 1:218374467-218374489 CGGGGGCCCCGTGGAGAAACTGG - Intronic
922793463 1:228323780-228323802 CTGGAGCCCCTTGGGGTAAGGGG + Intronic
922996437 1:229966039-229966061 CTGGGGCCACTTGGACAACCCGG - Intergenic
923367716 1:233279041-233279063 CTAGAGCTCTTTGGAAAAAACGG - Intronic
923405121 1:233652180-233652202 CAGGAGCTCCCAGGAAAAACAGG - Intronic
924237330 1:242010176-242010198 CTGGAACCCCTTGAAAGACCTGG - Intergenic
1063102828 10:2965327-2965349 CTGGAGACCCAGGGAAGAACTGG + Intergenic
1063936180 10:11080978-11081000 CTGGTGTTCCTTTGAAAAACAGG + Intronic
1064147649 10:12838167-12838189 CTGAAGCCACTTGGATAATCAGG - Intergenic
1065811629 10:29448511-29448533 CTTCAGGCCCTTGGAAAATCGGG + Intergenic
1065960156 10:30727635-30727657 CTTCAGGCCCTTGGAAAATCAGG - Intergenic
1066804232 10:39227938-39227960 TTTGAGGCCATTGGAAAAACTGG + Intergenic
1067542371 10:47165402-47165424 CTGGAGCCTCTTGGCATTACCGG + Intergenic
1067814346 10:49461136-49461158 CTGAAGCCACTTTGGAAAACAGG + Intronic
1071495199 10:86163176-86163198 CTGGAGCCACTTGAAACAACGGG + Intronic
1072535425 10:96359259-96359281 CTGCAGCCCTTTGGAAACAATGG + Exonic
1074473946 10:113752778-113752800 CTGGAGCCCTTTGCAGACACTGG + Intronic
1075788287 10:125065201-125065223 CTGGACCTCCCTGGAAAGACTGG - Intronic
1077534623 11:3117220-3117242 TGAAAGCCCCTTGGAAAAACTGG + Intronic
1079241962 11:18727796-18727818 CTGGAGCCCCTTGTGGAGACTGG - Intergenic
1079302427 11:19290193-19290215 CTGAAGCCCGTTGGAATCACTGG + Intergenic
1082033440 11:47624418-47624440 ATAAAGCCCCTAGGAAAAACAGG + Intronic
1082949245 11:58792754-58792776 AAAAAGCCCCTTGGAAAAACTGG - Intergenic
1083239406 11:61375788-61375810 TAAAAGCCCCTTGGAAAAACTGG + Intergenic
1083358849 11:62090960-62090982 ATAAAGCCCCTTGGAAAAACTGG + Intergenic
1084617194 11:70244412-70244434 CTTGAGCCCTTGGGAAAAGCAGG - Intergenic
1087437224 11:98136556-98136578 CTGGAGGCCTCTGTAAAAACAGG - Intergenic
1087524841 11:99296696-99296718 CTGGACTCCCTGGGAAAAACAGG - Intronic
1089488605 11:118866835-118866857 ATAAAGCCCCTTGGGAAAACTGG + Intergenic
1092206108 12:6614970-6614992 CTGGAGTCCCATGGAAGAAACGG - Intergenic
1092317046 12:7428071-7428093 CTGGTTGCCCTTGGCAAAACTGG + Intronic
1095076600 12:37936138-37936160 ATGGAGCAGCTTGGAAACACTGG - Intergenic
1095078448 12:37965011-37965033 ATGGAGCACTTTGGAAACACTGG + Intergenic
1095940863 12:47725832-47725854 CTGTGGCCCCTTGGAAAGTCAGG - Intergenic
1097254313 12:57660820-57660842 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1101188549 12:102307063-102307085 CTGGATTCCTTGGGAAAAACAGG + Intergenic
1101233779 12:102767740-102767762 CTGAAGCCCCCTGGTTAAACAGG + Intergenic
1103360008 12:120347865-120347887 CAGGATGCCCTTGGCAAAACAGG + Intronic
1103384664 12:120522766-120522788 CTTGAGCCCCTTGGCAATGCAGG + Intronic
1103990033 12:124792849-124792871 CTGTAGCCCCATGGAAATGCGGG - Intronic
1104030387 12:125061209-125061231 TAAAAGCCCCTTGGAAAAACTGG - Intergenic
1107600382 13:42006554-42006576 CTGGAGTCCCTCTGAAGAACTGG - Intergenic
1109249175 13:59997685-59997707 CTGTCGGCCTTTGGAAAAACTGG - Intronic
1109300457 13:60585238-60585260 ATGCAGCCTCTTGGAAATACAGG - Intergenic
1112318627 13:98387559-98387581 CTGGAGCCCACTGGAACACCAGG - Intronic
1114908279 14:27158653-27158675 TTGCATCCCCTTGGAAACACTGG - Intergenic
1115760689 14:36577656-36577678 CTTGAGCCCCTTGGCAATGCGGG + Intergenic
1116013426 14:39378000-39378022 CTGGAGCCCCTTGGAAAAACTGG - Intronic
1116678831 14:47939967-47939989 CTGGACTCCATGGGAAAAACAGG + Intergenic
1117481798 14:56153254-56153276 CTATAGCCATTTGGAAAAACGGG + Intronic
1118535551 14:66759331-66759353 GCAGAGCCCCTTGGGAAAACTGG - Intronic
1118938755 14:70313160-70313182 TATAAGCCCCTTGGAAAAACTGG + Intergenic
1120840109 14:89078196-89078218 CTGGAGCCACGTGGATAAACTGG - Intergenic
1120865763 14:89294081-89294103 CAGGAGCCCTTGGGAAGAACGGG - Intronic
1121469482 14:94140771-94140793 CTGGAGCGCCTTGGAGAGAAAGG + Intergenic
1123138543 14:106053103-106053125 TAAGAGCCCCTTGGGAAAACTGG - Intergenic
1123146558 14:106136614-106136636 ATAAAGCCCCTTGGGAAAACTGG - Intergenic
1123477937 15:20604311-20604333 CTGGAGCCCTTTGAAAAATAGGG - Intergenic
1123640077 15:22396072-22396094 CTGGAGCCCTTTGAAAAATAGGG + Intergenic
1125107856 15:35995071-35995093 CTGGAGCCATCTGGAAAAATTGG - Intergenic
1125826831 15:42683938-42683960 CTGGAGCCTCTTGGAGAACTAGG + Intronic
1127660676 15:61097459-61097481 CTGGAGCCCCCTTGGAGAACAGG - Intronic
1129427399 15:75473656-75473678 GTGGAGACCTTTGGAAAAAAGGG + Intronic
1129962701 15:79702384-79702406 CAGGACCCCCTTGGAGACACTGG - Intergenic
1131951546 15:97686903-97686925 GTAGAAGCCCTTGGAAAAACAGG - Intergenic
1132911106 16:2312310-2312332 ATGGTGCCCCATGGAAAAAGTGG + Intronic
1133397632 16:5461056-5461078 CAGGAGCCCCTTGGAAATGACGG - Intergenic
1134008320 16:10833197-10833219 GAGGAGCCCCTGGGAGAAACAGG + Intergenic
1134277414 16:12789104-12789126 CTGGATTCTCTTGGAAAATCTGG + Intronic
1135523357 16:23194349-23194371 CGGGAGCCCTCTGGAAAAGCGGG + Intronic
1135866028 16:26102822-26102844 CTGCAACGCCTTTGAAAAACTGG - Intronic
1136529292 16:30856689-30856711 ATAGAGCCCCTCGGAAAAGCTGG - Intronic
1136793004 16:32988116-32988138 ATAAAGCCCCTTGGGAAAACTGG + Intergenic
1136876851 16:33865939-33865961 ATAAAGCCCCTTGGGAAAACTGG - Intergenic
1137923999 16:52522382-52522404 CTGGTTCCCCTTGAAAAATCAGG + Intronic
1139096564 16:63711545-63711567 CTTGAGCCCATTGCAAAAAAAGG - Intergenic
1139247414 16:65459309-65459331 CTGCACCCACTTTGAAAAACCGG - Intergenic
1203095261 16_KI270728v1_random:1249808-1249830 ATAAAGCCCCTTGGGAAAACTGG + Intergenic
1143031325 17:3968951-3968973 GTGAAGCCCGTTGGGAAAACGGG + Intergenic
1143356144 17:6330302-6330324 CTGCAGGCCCTTGTAAAGACTGG - Intergenic
1147308232 17:39578341-39578363 CAGGAGCCCTTTGGAACCACAGG + Intergenic
1147358725 17:39918053-39918075 CTTGGGCCCCTTGGAACAAGGGG - Intronic
1149472655 17:56931272-56931294 TAGGAACCCCTTGGAAAAACTGG + Intergenic
1149558380 17:57590696-57590718 CTGGAGCCCCTTGGAAGTGTGGG + Intronic
1149973164 17:61239070-61239092 CTGGCACACCTAGGAAAAACTGG - Intronic
1150720012 17:67606449-67606471 TTGGAGCTCTTTGGAAAAGCTGG - Intronic
1151014995 17:70543745-70543767 CAGGTCCACCTTGGAAAAACAGG + Intergenic
1152828163 17:82480434-82480456 GTGGAGCCTCCTGGAAGAACCGG - Intronic
1153811951 18:8759893-8759915 CTGGGGCCCCCTGGAGAAACCGG - Intronic
1154107925 18:11540250-11540272 GTAAAACCCCTTGGAAAAACTGG + Intergenic
1154936396 18:21062181-21062203 CCAGAGCTCCTTGGAAAAAATGG + Intronic
1157811918 18:50703336-50703358 CTCTGGCCCCTTGGAAAAGCAGG - Intronic
1158149987 18:54357534-54357556 CTGAACTCACTTGGAAAAACTGG + Intronic
1159654972 18:71022481-71022503 CTGGAGGCCCTGGGAAAGAAAGG + Intergenic
1160611906 18:80095520-80095542 CCAGAGCCCCTTGAAAGAACAGG + Exonic
1162452147 19:10761680-10761702 CTGGGGCCCATTGGAAAGGCAGG - Intronic
1162520281 19:11175648-11175670 CTGAAGCCCCCAGGAAGAACAGG + Intronic
1162597499 19:11640270-11640292 CTCGAGCCCCTTGGAGACAAAGG - Intergenic
1165050108 19:33135724-33135746 GTGCAGCCACTTTGAAAAACGGG - Intronic
1165404248 19:35620058-35620080 CTGGAGCCCCTTGGGGACGCGGG - Exonic
926457579 2:13086837-13086859 TTAAAGTCCCTTGGAAAAACTGG + Intergenic
927127263 2:20023103-20023125 CTGGAGCTCCTGCCAAAAACAGG - Intergenic
928224738 2:29438906-29438928 CTGGAGCCCTAGGGAAGAACTGG - Intronic
929309754 2:40408716-40408738 CTGGTGCCCCTTCGAAATACAGG - Intronic
932965895 2:76474217-76474239 CTGGATGCCTTGGGAAAAACAGG + Intergenic
933399976 2:81783638-81783660 CTGGAACACCTGGGATAAACTGG - Intergenic
934670790 2:96211073-96211095 ATAGAGCCCCTTGGGAAATCTGG + Intergenic
938408790 2:131047100-131047122 CTGGCGCCCCTTGGCAGGACAGG - Exonic
939722207 2:145667878-145667900 CTGGAGGACCTGGGAAAAACGGG - Intergenic
943468816 2:188266239-188266261 ATGGAGCCACTGAGAAAAACTGG - Intergenic
944110455 2:196125908-196125930 CTGGACACAATTGGAAAAACTGG - Intergenic
945869559 2:215212375-215212397 TAAAAGCCCCTTGGAAAAACTGG + Intergenic
945912096 2:215661158-215661180 GTAGAGCCCTTGGGAAAAACAGG + Intergenic
946791427 2:223304291-223304313 ATGGAACCACTTGGAGAAACAGG + Intergenic
948209323 2:236180418-236180440 TTGGAGAACCTTGGAAAACCAGG - Intergenic
949030118 2:241791442-241791464 TGAAAGCCCCTTGGAAAAACTGG + Intronic
1168947289 20:1771869-1771891 CTGGAGACCCTCTGAAGAACTGG - Intergenic
1172718681 20:36983017-36983039 CTGGAGCCCCTAGGATGAATGGG + Intergenic
1175676017 20:60947636-60947658 CTGGAGCACCTTGGGAAGCCTGG - Intergenic
1176270127 20:64231998-64232020 CTGGAGCCTCAGGGAAGAACTGG - Intronic
1176863135 21:14025145-14025167 CTGAAGTCTCTTGGAAAAACTGG - Intergenic
1177685859 21:24436417-24436439 CAGGAGACTCTTGGAAGAACTGG + Intergenic
1179540491 21:42080301-42080323 TTGGAGGCCCCTGGAAATACTGG + Intronic
1180159952 21:45994539-45994561 TTGGAGCCCCTGGGAGACACTGG + Intronic
1184963997 22:47953571-47953593 CCGGAGCCCACTGGAGAAACTGG + Intergenic
1185097587 22:48819949-48819971 CTGCAGGCCCCTGGAAACACGGG - Intronic
1185199213 22:49491617-49491639 CTGGCGCCCCTTGGAAGTGCTGG + Intronic
949962827 3:9328420-9328442 CTGGACTCCTTGGGAAAAACAGG - Intronic
950011349 3:9726389-9726411 CTGGAGACCTTTGGAACAAAAGG - Intronic
950605716 3:14078215-14078237 CTGGACTCCTTGGGAAAAACAGG - Intronic
952454379 3:33458763-33458785 TTAAAGCCCCTTGGGAAAACTGG - Intergenic
952772674 3:37016637-37016659 CCTGAGCCCCTTGGCAATACGGG + Intronic
954004552 3:47580345-47580367 CTGGAGAGCCTTGAAAAAAGGGG + Exonic
954620722 3:51993878-51993900 CCTGAGCCCCTTGGCAATACGGG + Exonic
954881241 3:53837389-53837411 CTGGATCCTCTTGGTAAAAAGGG + Intronic
961099801 3:124188955-124188977 TTGTAGCCTCTTGTAAAAACTGG - Intronic
961480481 3:127176315-127176337 CTGATGCTCCTTGGAAAGACTGG - Intergenic
962083382 3:132164692-132164714 CTGGATCCCTTTGAAAAAGCTGG + Intronic
962444049 3:135449264-135449286 CTGGAGCTGCTTGGAAAAAGTGG + Intergenic
964460763 3:156924055-156924077 GTGCAGCCCCTTTGGAAAACAGG - Intronic
964859180 3:161181621-161181643 TCAAAGCCCCTTGGAAAAACTGG - Intronic
965588456 3:170340511-170340533 CTGGACTCCTTGGGAAAAACAGG - Intergenic
968393236 4:210395-210417 CTGAAGTCTCTTGGAAAAACTGG - Intergenic
968402345 4:308710-308732 CTGAAGTCTCTTGGAAAAACTGG + Intergenic
968847340 4:3052404-3052426 CTGGGACTCCTTGGGAAAACAGG + Intergenic
969634878 4:8362526-8362548 CAGGAGACAATTGGAAAAACTGG + Intergenic
971178940 4:24309415-24309437 CTGGAGCCTCATGGGAAAAGTGG + Intergenic
972496356 4:39638663-39638685 GAGGAGCCCCCAGGAAAAACTGG + Intronic
975730351 4:77331797-77331819 ATAGAGCTCCTTGGGAAAACAGG - Intronic
981418250 4:144518841-144518863 CTGGAGCTCCCTAGGAAAACTGG - Intergenic
983694875 4:170515714-170515736 TAAAAGCCCCTTGGAAAAACTGG - Intergenic
987525128 5:19038425-19038447 CTCGAGCCCCTTGCATAAAATGG + Intergenic
988157611 5:27475625-27475647 TGGGAACCCCTTGGGAAAACTGG + Intergenic
989260651 5:39416302-39416324 CTGAAGCCCTTTGGAGAAAATGG - Intronic
989336996 5:40329861-40329883 CTGGACGCCTTGGGAAAAACAGG - Intergenic
995417358 5:111925758-111925780 CTGGAGGGCCTATGAAAAACTGG - Intronic
997457743 5:134029954-134029976 ATGTAACCCCTTGGGAAAACTGG + Intergenic
997587111 5:135050036-135050058 ATGTAGCCACTAGGAAAAACTGG + Intronic
1002341564 5:178519536-178519558 CTGGCTTCTCTTGGAAAAACTGG - Intronic
1002997753 6:2303233-2303255 CTGGAGCCCCTTGAATGAAGGGG + Intergenic
1005488448 6:26323413-26323435 CGGGAACCTCTTGGAAAGACTGG + Intergenic
1006819465 6:36880266-36880288 CTGGAATCCATGGGAAAAACAGG + Intronic
1007947399 6:45838580-45838602 CTGGAGACTCTTGGCAAAACTGG - Intergenic
1014146052 6:117999303-117999325 CCTGAGCCCCTTGGCAATACGGG - Intronic
1016854464 6:148652668-148652690 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1017404752 6:154107209-154107231 CTGGACTCCTTGGGAAAAACAGG - Intronic
1017441237 6:154466263-154466285 CTGGAGCCCTTAGGATATACAGG - Intronic
1019119379 6:169791014-169791036 CTGGAGTCCCTAGGAAATCCAGG - Intergenic
1020341403 7:7115088-7115110 ATGGAGGACCTAGGAAAAACAGG - Intergenic
1023623426 7:42094833-42094855 CTGGGGCTCCTTGGAGCAACTGG - Intronic
1025758107 7:64364274-64364296 TAAAAGCCCCTTGGAAAAACTGG - Intergenic
1025768865 7:64484654-64484676 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1027216677 7:76188337-76188359 CTGGGGCCCCTTGGACAACCAGG + Intergenic
1031305068 7:120115718-120115740 CTGGACTCCCTGGGAAAAACAGG + Intergenic
1032686423 7:134239011-134239033 CTGGGGCCCCTTGCTAAGACAGG - Intronic
1033503384 7:141976352-141976374 CTGGAGCTTCCTGGAAAAGCTGG - Intronic
1034903358 7:154921926-154921948 CTGGGACCCATTGCAAAAACAGG + Intergenic
1036121335 8:6020833-6020855 CATGAGCCCCTGGGACAAACTGG - Intergenic
1038581021 8:28749506-28749528 CTGGGGGCCTTTGGAAACACTGG - Intronic
1040578474 8:48675186-48675208 CAGGAGCCACTTGTAACAACTGG - Intergenic
1041296910 8:56366371-56366393 TAAAAGCCCCTTGGAAAAACTGG - Intergenic
1041713474 8:60913524-60913546 ATGGTGCCCCTTGGAAGAAATGG + Intergenic
1043578889 8:81689298-81689320 GTGAGGCCTCTTGGAAAAACTGG - Intergenic
1044032827 8:87259772-87259794 CTGGACTCCTTAGGAAAAACAGG - Intronic
1045320592 8:101079308-101079330 CTGGAGCCCCTTGCAAGGACTGG + Intergenic
1045428481 8:102090933-102090955 TAGAAGCCCCTTGGGAAAACTGG + Intronic
1046387774 8:113525728-113525750 TAGAAGCCCCTTGGGAAAACTGG + Intergenic
1047878726 8:129169463-129169485 CTTGAGGGCCTTGCAAAAACAGG - Intergenic
1048002237 8:130388214-130388236 CTGAAGCCTCTTGGGGAAACGGG + Intronic
1049500526 8:142960955-142960977 CTGGACTCCCTGGGAAAAACAGG + Intergenic
1049521362 8:143092976-143092998 CTGGATCCCTTAGGAAAAGCAGG + Intergenic
1049629213 8:143643244-143643266 CTGGAGGCCCTGGGGAAAACTGG - Intronic
1050580135 9:7045563-7045585 CTAGAGGCCTTTGGAATAACTGG - Intronic
1051729992 9:20131096-20131118 CTGGACCCCCTTTTATAAACAGG - Intergenic
1052103327 9:24478706-24478728 TTGGATCCACTTGGATAAACTGG - Intergenic
1052173270 9:25427494-25427516 CTGGGGCCCCAGGGAAAGACAGG - Intergenic
1052663631 9:31467972-31467994 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1053426249 9:38012066-38012088 GAGGAGCCCCTGGGAGAAACAGG + Intronic
1055970845 9:81911319-81911341 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1056592825 9:87977539-87977561 ATACAACCCCTTGGAAAAACTGG + Intergenic
1056727613 9:89135217-89135239 CAAAAGCCCCTTGGGAAAACTGG + Intronic
1056760774 9:89413160-89413182 CAGGAGCCCATTAGAAAGACAGG + Intronic
1056993470 9:91432096-91432118 CGGTAGCCCCTGGGAAAGACAGG - Intergenic
1057948587 9:99351796-99351818 TTTGAGCCCATTGGAATAACTGG + Intergenic
1058450098 9:105088574-105088596 GGGGAGCTCCTTGGAAAATCAGG - Intergenic
1059395498 9:114031843-114031865 CTAGAGCACCTTGGAAAAGCTGG + Intronic
1059499569 9:114739397-114739419 CAGGAGCCCCTTAGAAACAGAGG - Intergenic
1059751629 9:117253227-117253249 CTGTAGCCCCTTTGAACAAATGG - Intronic
1060813537 9:126623307-126623329 CAGGAGTCTCTTGGAAAAAATGG - Intronic
1060940553 9:127540836-127540858 CTGGAGCCCACTGGAGAGACCGG - Intronic
1062165975 9:135107457-135107479 TTCGAGCCCCTTTGAAAAATGGG + Intronic
1062259561 9:135654615-135654637 TAAAAGCCCCTTGGAAAAACTGG + Intergenic
1186300139 X:8191539-8191561 CTGGAGACTCCTAGAAAAACTGG + Intergenic
1186838673 X:13463453-13463475 CTGGAAGCCCCTGGAAAATCTGG + Intergenic
1187777794 X:22783100-22783122 CTGGAGACCTGTGGAAAATCAGG - Intergenic
1189713266 X:43837829-43837851 CAGGAGTCCCATGGAAGAACTGG - Intronic
1189864099 X:45306137-45306159 TAAAAGCCCCTTGGAAAAACTGG + Intergenic
1190136147 X:47800019-47800041 TAAAAGCCCCTTGGAAAAACTGG - Intergenic
1190769938 X:53505834-53505856 GAAAAGCCCCTTGGAAAAACTGG + Intergenic
1192444624 X:71201541-71201563 TTGGAGCCATTTGGAAAAAGAGG + Intergenic
1194085965 X:89529031-89529053 TAGAAGCCCCTTGGGAAAACTGG - Intergenic
1194230296 X:91314386-91314408 CTGGAGCCCCTGGAAAATACTGG + Intergenic
1195068402 X:101257710-101257732 CTGCAGGCCCTGGGAAACACTGG + Intronic
1195467403 X:105195211-105195233 CTGGAGCTCCTTGAAGAATCTGG + Intronic
1195581424 X:106507932-106507954 CTAAAGCCCTTTGGAAAAACTGG + Intergenic
1197565526 X:128079802-128079824 TAAAAGCCCCTTGGAAAAACTGG - Intergenic
1198498308 X:137215995-137216017 CTGGACACCTTGGGAAAAACAGG + Intergenic
1198703342 X:139420299-139420321 CTGGATAACCTTGGGAAAACAGG + Intergenic
1198848153 X:140935960-140935982 CTGGAGACCCAGGGAAGAACTGG + Intergenic
1200438620 Y:3184898-3184920 TAGAAGCCCCTTGGGAAAACTGG - Intergenic
1200898475 Y:8402818-8402840 TAAAAGCCCCTTGGAAAAACAGG + Intergenic
1200912474 Y:8543361-8543383 CTGGACCCACTTTGAAAAAAGGG + Intergenic
1201749323 Y:17415246-17415268 CTGGAACTCCTTGGAGAAACAGG + Intergenic