ID: 1116017706

View in Genome Browser
Species Human (GRCh38)
Location 14:39427222-39427244
Sequence TTTTTATTCCACAGCTGTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 328
Summary {0: 1, 1: 0, 2: 4, 3: 22, 4: 301}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116017706_1116017708 8 Left 1116017706 14:39427222-39427244 CCAATACAGCTGTGGAATAAAAA 0: 1
1: 0
2: 4
3: 22
4: 301
Right 1116017708 14:39427253-39427275 ACCTCTCATAACAGCCTTCCAGG 0: 1
1: 0
2: 0
3: 13
4: 183
1116017706_1116017710 11 Left 1116017706 14:39427222-39427244 CCAATACAGCTGTGGAATAAAAA 0: 1
1: 0
2: 4
3: 22
4: 301
Right 1116017710 14:39427256-39427278 TCTCATAACAGCCTTCCAGGAGG 0: 1
1: 0
2: 0
3: 17
4: 205

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116017706 Original CRISPR TTTTTATTCCACAGCTGTAT TGG (reversed) Intronic
900677682 1:3899042-3899064 TTTTTTTTCCACAACTTTTTTGG - Intronic
902094464 1:13931239-13931261 TTTTTATTACACAGCTGTAATGG + Intergenic
902938637 1:19783421-19783443 TTTTTATTGCTCAGCTAGATGGG - Intronic
903274111 1:22209882-22209904 CATTTATTCCACTGCTGTCTGGG - Intergenic
903565066 1:24259054-24259076 TTTTGGGTCCACTGCTGTATTGG - Intergenic
905002998 1:34688152-34688174 TCTTAATTCCACAGCTGGAAGGG - Intergenic
905154581 1:35965011-35965033 TTTTTATTCCTAAGATGTTTTGG + Intronic
906765044 1:48422055-48422077 TCATTATTCCAAATCTGTATTGG - Intronic
910249584 1:85181951-85181973 TTTTTATTCCATTACTGTTTAGG - Intronic
913428623 1:118763501-118763523 TTTGTATCCTACAGCTTTATTGG - Intergenic
915035454 1:152920028-152920050 TTTTTTTTCAAGAGCTGTAGCGG + Intergenic
918012293 1:180598583-180598605 TTTTTTTTTCCCAGCTGTCTTGG - Intergenic
919997046 1:202761765-202761787 TTATTTTTTCACAGTTGTATAGG - Intronic
920367085 1:205453834-205453856 TTTTTCTTTAACAGCTTTATTGG - Intronic
921780864 1:219161814-219161836 TTTTTCTTCCACAGTTGATTTGG - Intergenic
924503714 1:244660928-244660950 CTATTATTCCAAAGCTTTATTGG + Intronic
924614124 1:245598787-245598809 TGTTTATTCCACGGATGGATTGG - Intronic
1063631488 10:7738477-7738499 TTTTTATTCCAGAGTTCTCTCGG - Intronic
1064350392 10:14570874-14570896 TTTTTAATCCACAACTGTGAAGG + Intronic
1064526283 10:16260211-16260233 TTTTTCTTCAGTAGCTGTATGGG + Intergenic
1064869033 10:19916726-19916748 TTTCTAATCCACAGATCTATGGG - Intronic
1065563935 10:26990280-26990302 CTTATGTTCCACAGCTGTGTGGG + Intergenic
1065602299 10:27381622-27381644 TTTTTATTTCACAGCTTTTTTGG - Intergenic
1066057503 10:31695643-31695665 TTGTTATGACACAGCAGTATTGG + Intergenic
1067690061 10:48496098-48496120 TTATTATCCCACAGCTCTGTGGG - Intronic
1068294385 10:55050618-55050640 TATTTATTCCAAAGCTGTATTGG + Intronic
1068863808 10:61873503-61873525 ATTTTACTTCACAGCTGCATTGG + Intergenic
1070414408 10:76176161-76176183 TTTGTCTTCCACAGGTGTATGGG + Intronic
1073072106 10:100801119-100801141 TATTTAGTCCACAGCTGTCAGGG + Intronic
1073932985 10:108598232-108598254 TTGTTATTACACAGGTGTGTAGG + Intergenic
1074246533 10:111699308-111699330 TTTTTATTACACAGCTGAAAGGG - Intergenic
1076231830 10:128826164-128826186 TTGTGATTTCACAGCTGTGTTGG - Intergenic
1076366832 10:129926672-129926694 TGTTTATTCCACACCTTTTTTGG - Intronic
1078283173 11:9923195-9923217 TTTTTATTCCAAAGCTAGTTTGG - Intronic
1078871327 11:15347917-15347939 TGTTTATCCCACTGCTGGATGGG - Intergenic
1080109995 11:28556050-28556072 TTATTATTCCACAGATTTCTAGG + Intergenic
1081188455 11:40074353-40074375 TGTTTATCCTAGAGCTGTATTGG + Intergenic
1085361632 11:75893247-75893269 TTTCTATTCCACTTCTGTTTGGG - Intronic
1086383882 11:86287501-86287523 TTTTTATTCCACATCAGCCTGGG - Intergenic
1087172421 11:95063355-95063377 TTTTTTTTCCACAACCGTATTGG + Intergenic
1087637463 11:100718148-100718170 TTTTTATTCCAAAGGTATGTGGG + Intronic
1087965081 11:104403123-104403145 TTTTTATTCCAAAGCTTGCTAGG + Intergenic
1089716639 11:120366550-120366572 TTTTTCTTCCACAAAAGTATTGG + Intronic
1090634393 11:128681468-128681490 ATATTATTCCACAGTTGTATTGG + Intergenic
1091346913 11:134860923-134860945 TTTTTTTTCCATAAATGTATTGG - Intergenic
1091485118 12:879234-879256 TTTTTTTTTAACAGCTTTATTGG - Intronic
1093480235 12:19596946-19596968 TTTTTATTGCTCATCTGGATTGG - Intronic
1093495504 12:19752227-19752249 TTTTTATTCAAAAGAAGTATTGG - Intergenic
1095202168 12:39396856-39396878 TTTTTATTGCAGAGCAGTGTTGG - Intronic
1095845867 12:46743709-46743731 TTTTTATTCCACTGTGGTCTAGG - Intergenic
1096903554 12:54910810-54910832 TTTGTATTCTACAGCTTTACTGG - Intergenic
1097179822 12:57165401-57165423 TTTTTATTTCACAGTTTCATCGG - Intronic
1098528381 12:71512548-71512570 CTTTTATTTCAAAGCTGTACAGG + Intronic
1098800254 12:74948297-74948319 TTTTTAAGGCACACCTGTATAGG + Intergenic
1101503745 12:105328199-105328221 TTTTTGTTACACGGATGTATTGG + Intronic
1101574748 12:105987151-105987173 TTTATTTTCCACAGCTCTGTGGG + Intergenic
1101693092 12:107098852-107098874 TTTTTTTTAAACAGCTGTGTGGG + Intergenic
1102168063 12:110821781-110821803 TTTTTTTTTAACAGCTTTATTGG - Intergenic
1102885670 12:116519906-116519928 TATTCATTCCACAGCTTCATAGG + Intergenic
1102926988 12:116833846-116833868 TATTTGTACCACAGCTGGATGGG - Exonic
1103810495 12:123609683-123609705 TTTTTAATAAACAGCTTTATGGG + Intronic
1104097702 12:125573461-125573483 TTTGTTTTCCACAGCAGTATGGG - Intronic
1105279202 13:18953374-18953396 TTTTTTCTCCATAGCTATATTGG + Intergenic
1105953336 13:25254112-25254134 TTTTTAAACCACAGCTTTAAAGG + Intronic
1106523272 13:30517339-30517361 TTCTCATTCAACAGCTGTCTGGG + Intronic
1107557806 13:41533073-41533095 CTTTTATTCTAAAGATGTATTGG - Intergenic
1107640564 13:42438972-42438994 TTATTATTTCACAGTTTTATAGG - Intergenic
1107777979 13:43866921-43866943 TTTTTCTTGCATAGCTGTACTGG + Intronic
1108537247 13:51396785-51396807 TTTTTATGCCACTGATTTATTGG - Intronic
1109288373 13:60440321-60440343 TTTTTTTTCCATAATTGTATTGG + Intronic
1111236436 13:85414861-85414883 TTTTTATTCCAGACTTGTAATGG - Intergenic
1111590724 13:90345082-90345104 TATTTCTTCCACAGTTGTTTTGG + Intergenic
1111946907 13:94675557-94675579 TATTTATTGCACACCTGTAATGG - Intergenic
1112035424 13:95492589-95492611 CTTTTCTTCCACAGCTGGAAGGG - Intronic
1112048374 13:95620604-95620626 GTGTCATTCCACAACTGTATTGG + Intronic
1114340650 14:21739457-21739479 TTTCTATTTCACAGCTTTAGGGG - Intergenic
1114476385 14:22998142-22998164 CTTCTCTTCCACAGCTGTCTCGG - Intronic
1115420393 14:33187253-33187275 TCTCCATTCCACAGCTGTATTGG + Intronic
1116017706 14:39427222-39427244 TTTTTATTCCACAGCTGTATTGG - Intronic
1116832313 14:49733232-49733254 TTTTTGTTCCAGAGCTGTAGAGG + Intronic
1117056935 14:51921894-51921916 TGTTTATTGCAAATCTGTATGGG - Intronic
1117094277 14:52281844-52281866 TTTGTGTTCCACAGCTGTGGGGG - Intergenic
1117456298 14:55900186-55900208 TTTATAGTCCACAGTAGTATAGG - Intergenic
1117645908 14:57852524-57852546 TTTCTAGTCCACATCTGTGTAGG - Intronic
1117977177 14:61310286-61310308 TTTTTATTTTACAGGTTTATAGG - Intronic
1118347762 14:64952024-64952046 TCTCAATTCCACAGCAGTATGGG - Intronic
1118927527 14:70206398-70206420 TTTTTATTCCTCATCTGACTTGG + Intergenic
1119403431 14:74379779-74379801 TTTTAATTATACACCTGTATAGG - Intergenic
1119588082 14:75857142-75857164 TTTCTATTCAACAGCAGTAAAGG - Intronic
1119816711 14:77575488-77575510 TTTTTATGCCCTAGCTGTACAGG - Intronic
1119934364 14:78577335-78577357 ATATTATTCCAAAGATGTATGGG + Intronic
1120963981 14:90151118-90151140 TCATTGTTCCACAGCTGTACAGG - Intronic
1121909117 14:97773033-97773055 TTAGTTTTCCATAGCTGTATAGG - Intergenic
1124104420 15:26724256-26724278 TTTTTATTTCTCAGCTGTGATGG - Intronic
1124355276 15:28990713-28990735 TTTTTATTCCAGATTTGAATTGG - Intronic
1125189430 15:36973025-36973047 TCTTTCTTCCACAGCTGTGTTGG - Intronic
1125392786 15:39213114-39213136 GTTTTATTTCAAAGCTGTTTGGG - Intergenic
1131576061 15:93592390-93592412 TTTTTACTCTACAGCTTTGTAGG - Intergenic
1131608003 15:93929750-93929772 TTTTTCTCCCACAGCTGTCTTGG + Intergenic
1134469989 16:14515508-14515530 TTTTTCTGCCACTGCTTTATGGG - Intronic
1137470928 16:48757816-48757838 TTTTTATTCAACAAGTATATGGG + Intergenic
1138194078 16:55039855-55039877 TTCTGATTCCACAGATGTAGAGG - Intergenic
1138707811 16:58935682-58935704 TTTTTTTTCCTCAGGTATATTGG + Intergenic
1140240621 16:73196648-73196670 TTTTCATTCCATAGCTACATGGG - Intergenic
1140761870 16:78116712-78116734 TAATTATTCCACAATTGTATGGG - Intronic
1140912057 16:79463069-79463091 GTTTTCTTCCCCAGCTTTATGGG - Intergenic
1142776457 17:2143854-2143876 TTTTTTCTCCACAACTGTACTGG + Intronic
1144257385 17:13482076-13482098 TTTTTCTTGCACTGCTGTAAAGG - Intergenic
1145350210 17:22075188-22075210 TTTTTTTTCCCCTTCTGTATTGG - Intergenic
1146618696 17:34378448-34378470 TTTTTATTGAAAAGATGTATAGG + Intergenic
1149120673 17:53160124-53160146 TTTTTAGTCCATAGCTGTGATGG - Intergenic
1149279850 17:55091197-55091219 TTTATATTCCCCACCTGTAGTGG - Intronic
1149733742 17:58972810-58972832 TTTTTATTGCATTGCTGTTTAGG + Exonic
1149756991 17:59195184-59195206 TTTTTATTCCAGAGCTTCAAAGG - Intronic
1150665336 17:67130315-67130337 TCTTTTTTCGACAGCTTTATGGG - Intronic
1153213080 18:2789472-2789494 TTTTCATTCCACAGGTTTAAAGG - Intronic
1153926634 18:9840365-9840387 TTTTTTTTCAACAAGTGTATAGG - Intronic
1155388425 18:25307040-25307062 TCTGAATTCCTCAGCTGTATTGG - Intronic
1155463799 18:26113570-26113592 TTTTTAGTCCACAGTTGTTTGGG + Intergenic
1155730222 18:29148175-29148197 GATCTATCCCACAGCTGTATAGG - Intergenic
1160233142 18:77064168-77064190 TTTTTATTCTAGAGTTTTATAGG + Intronic
1160439852 18:78881163-78881185 TTTTTACTCTACAGCATTATTGG + Intergenic
1163894764 19:20048963-20048985 TTTTTTTTCCACAGTTTTCTTGG - Intergenic
1164866620 19:31609715-31609737 TGTTTCTTCCTCAGCTGTCTGGG + Intergenic
925414893 2:3662603-3662625 TTTTTATTTTACAAATGTATTGG + Intronic
926477606 2:13346139-13346161 TTTTTATTTAAGAGCTTTATTGG - Intergenic
927200748 2:20576721-20576743 TTTTTATTCCACAACAGAAATGG + Intronic
927309980 2:21619395-21619417 TTTTTGTTACACATCTGTAATGG + Intergenic
928444517 2:31321020-31321042 TTATTATTCCACAGTTCTGTAGG - Intergenic
930726293 2:54685194-54685216 TTTTTATTGCACAACGGTTTTGG - Intergenic
931025463 2:58109421-58109443 TTTTTTTTTCATAGCAGTATGGG - Intronic
931454929 2:62401843-62401865 TTTTTTTTCCAAAGTTGTTTTGG - Intergenic
933293034 2:80458938-80458960 TTTTAATTGTACATCTGTATAGG - Intronic
933586232 2:84182214-84182236 TTGTTATTCCACAGTTCTGTAGG - Intergenic
934106520 2:88699995-88700017 TTTTGTTTCCACAGCTGAAAGGG + Exonic
934486585 2:94719454-94719476 TTTTTATTATACAGTTCTATGGG - Intergenic
934925880 2:98381499-98381521 TTTTCATTCCATATTTGTATGGG + Intronic
934931840 2:98432621-98432643 TATATATTCCAAAGTTGTATGGG + Intergenic
935074397 2:99726719-99726741 TTGTTACTGCACAGCTGTGTGGG + Intronic
936276636 2:111103397-111103419 ATTTCCTTCCACAGATGTATCGG - Intronic
936734678 2:115426903-115426925 TTTTTATTCTACAAGTTTATAGG - Intronic
937680987 2:124644351-124644373 CTTTTCTTCCTCAGCTGCATTGG - Intronic
938125562 2:128668541-128668563 TTTTTATGACACAGCTTTAAAGG - Intergenic
939065332 2:137476850-137476872 CTTTTATTCCACTGTGGTATAGG + Intronic
939356047 2:141103669-141103691 TTTTTTTTTCACAGTTGTATTGG - Intronic
939914772 2:148025227-148025249 ATTGTATTCCACAAGTGTATTGG + Intronic
940477641 2:154185093-154185115 TTTTTATTTGACAGCTTTAGTGG + Intronic
941015417 2:160350412-160350434 TTGTTATTACACAGATGTAATGG - Intronic
941410649 2:165152986-165153008 TTTTTTTTTCAAAGCTGTTTTGG - Intronic
941453842 2:165692539-165692561 TTCCTATTCCACAACTCTATAGG - Intergenic
942507610 2:176660205-176660227 TTTGTATTCAACACCTGGATAGG + Intergenic
943981355 2:194555259-194555281 TTTTTATTCTTGAGCTGAATAGG + Intergenic
944491615 2:200263426-200263448 TTTTTATTTTACAGGTTTATAGG + Intergenic
945278382 2:208011739-208011761 TTTTTATTCCATAGGTTTGTGGG - Intronic
945672489 2:212819021-212819043 TCTTTGTCCCACAGCTGTCTGGG - Intergenic
947863036 2:233376010-233376032 ATTTCATTCCACAGCTCGATAGG + Intronic
1169302910 20:4460502-4460524 TTTTTTTTCCAAAAGTGTATTGG - Intergenic
1172001026 20:31776970-31776992 TTTTTCCTCCACAGGTGAATTGG - Intronic
1172198358 20:33107730-33107752 TTTTTATTTTACAGCTGTGCTGG + Exonic
1173022365 20:39277568-39277590 TGATTATTTCACAGTTGTATAGG - Intergenic
1177143744 21:17384989-17385011 TTTTTATTCCATAGGTTTTTGGG + Intergenic
1177949171 21:27512269-27512291 TTTTTATCCCACAGCTCTGGAGG + Intergenic
1178028972 21:28503342-28503364 TTTTTATACCATACCTATATGGG - Intergenic
1178893335 21:36538760-36538782 TTTTTTTTCCACAGTTGGAGTGG + Intronic
1179933434 21:44587649-44587671 TTTTTATACCAATGCTGTTTTGG - Intronic
1181719114 22:24760334-24760356 TTTTTCTTCCACTGCTGGCTTGG - Intronic
1182731385 22:32498130-32498152 TCTTTTTTCTACAGCTGTACAGG + Exonic
1184954416 22:47874703-47874725 TTTTTATACAACAGCAGTACAGG + Intergenic
949318166 3:2780041-2780063 TCTTAATCCCACAGCTGTAATGG + Intronic
949375057 3:3380163-3380185 TTTTTATTCCCCAGCTTGAAAGG - Intergenic
949422856 3:3884683-3884705 TTTATTTTTCACAGCTGTAGAGG - Intronic
950776879 3:15357815-15357837 TTCTTATTCTGCAGCTATATTGG - Intergenic
951253600 3:20423099-20423121 TTTTTTTTTCACAGCTTTCTAGG - Intergenic
951351160 3:21608782-21608804 CTTTTATTTCACAACTGGATTGG - Intronic
951370945 3:21846939-21846961 TTTTTATGCCATAGCTTCATAGG - Intronic
951777768 3:26328250-26328272 TTTTTATTCCACTGTGGTCTGGG - Intergenic
952082165 3:29772255-29772277 TTATTATCTCACAGTTGTATAGG - Intronic
952218097 3:31297469-31297491 TTTTTATTCCCCAGCTTTTCTGG - Intergenic
953739132 3:45521683-45521705 TTTTTTCTCCACAAATGTATTGG - Intronic
956334345 3:68146481-68146503 TTTTTATTCCACAGTCCTTTGGG - Intronic
957804532 3:85130349-85130371 TTTTTTTTCAACAATTGTATTGG - Intronic
958456541 3:94338735-94338757 TTTTTATTCCAAAGTTTCATGGG + Intergenic
958878851 3:99646124-99646146 TTTCCATTGCACAGCTGTGTGGG + Intronic
961581208 3:127884160-127884182 TTTGTTTTCCACAGCTGACTGGG + Intergenic
962335716 3:134528122-134528144 TTGTTTTTCCAGAGCTGTTTGGG + Intronic
963682921 3:148403292-148403314 TTTTTCTTGCAAAGTTGTATGGG - Intergenic
964433989 3:156633347-156633369 TTTTTATATGACAGCTGCATGGG - Intergenic
964800672 3:160554022-160554044 TATTTATTCAGCATCTGTATTGG - Intronic
965093510 3:164192921-164192943 TTTTTATTCTAGAGATCTATGGG - Intergenic
967266046 3:187693157-187693179 TTTTTATTTCTCAGCAGTCTGGG + Intergenic
970926354 4:21457037-21457059 TTTTTTTTCCACAACTGAAGAGG - Intronic
971626133 4:28922337-28922359 TTTTGATTCCAAAGCTTAATTGG + Intergenic
971989982 4:33880224-33880246 TTTTTTTTCCTCAGGTGGATTGG + Intergenic
972183323 4:36496741-36496763 TTTTTATTTCATAATTGTATTGG + Intergenic
972994881 4:44868172-44868194 TTTTTATTCCACAGTGGTATGGG + Intergenic
973034556 4:45390195-45390217 TGTTTCTTCCTCATCTGTATGGG + Intergenic
974070537 4:57119425-57119447 TCTTTCTTCCACTGCTGTAGCGG + Intergenic
974278960 4:59764953-59764975 ATTTTATTCCTCAGTTCTATAGG - Intergenic
974570799 4:63646170-63646192 TTATTTTTCCACTTCTGTATTGG + Intergenic
976434409 4:85000677-85000699 TTTTTATTCGAAAGGTTTATGGG + Intergenic
976564649 4:86539933-86539955 TTTTTAATCCAGGGCTGCATCGG - Intronic
977366440 4:96074899-96074921 ATTTTATTGAACATCTGTATTGG + Intergenic
977753237 4:100634457-100634479 ATTTTTTTCCTCAGCTTTATTGG - Intronic
978693933 4:111552828-111552850 TTTTTTTCCAACAGCTTTATTGG + Intergenic
978817850 4:112929877-112929899 TTTTCTTTCAACATCTGTATAGG - Intronic
978923296 4:114212848-114212870 ATTTTATTCCAGAGATGTAAAGG + Intergenic
980513918 4:133828409-133828431 TTTTTATTCTATAAATGTATAGG - Intergenic
981194036 4:141897509-141897531 TTTTTATTTTACATATGTATAGG + Intergenic
981509562 4:145541020-145541042 TTTTCAGTCCAAAGCTGTTTGGG + Intronic
982292609 4:153793390-153793412 GTTTTAGTCCACAGCTGACTGGG + Intergenic
982454537 4:155593009-155593031 TATTTATTCCTCTGCTGTCTGGG + Intergenic
982994472 4:162323564-162323586 TTTTTCTTCAACTGCTCTATGGG - Intergenic
983551383 4:169020907-169020929 ATTATATTTCACAACTGTATTGG - Intergenic
983647989 4:170011276-170011298 TTTTTTTTCCACAGATTTCTTGG - Intronic
983786251 4:171733235-171733257 TTATTATTCCAGAGCTTTATTGG - Intergenic
986113737 5:4749336-4749358 TTTTTATACCTCACGTGTATAGG + Intergenic
986502802 5:8417846-8417868 TTTCTGTTCCCCAGCTGTACTGG - Intergenic
986869147 5:12027412-12027434 TTTTTGTTTCACAGGTTTATAGG - Intergenic
986986586 5:13507177-13507199 TTTTTGTTCAAATGCTGTATTGG + Intergenic
988555830 5:32235203-32235225 TGCTTATTCCACAGCTGTTGAGG - Intronic
988647942 5:33116187-33116209 TTTTTATTCCATAGGTTTTTGGG - Intergenic
988912027 5:35852815-35852837 TTTTTTTTCCACAGCTCTTGTGG + Intronic
989698186 5:44229577-44229599 TTTTTATTCCATAGGTTTGTCGG + Intergenic
990071187 5:51785063-51785085 TTTTTATTCCACTGTGTTATAGG - Intergenic
990691221 5:58366519-58366541 TTTTTTCTCAACAGGTGTATTGG + Intergenic
991157148 5:63452141-63452163 TTTTGATTTAACAGCTATATTGG + Intergenic
991202604 5:64011656-64011678 TGTTTATTGCACAGCTGCAGGGG + Intergenic
992193688 5:74318555-74318577 TTTCTATTCCACAGTAGTCTAGG + Intergenic
992266077 5:75019401-75019423 ATTTTATTCCACAAATGTCTCGG - Intergenic
992612308 5:78518136-78518158 TTTTAATGCCACTGCTTTATAGG + Intronic
994057402 5:95433768-95433790 TTTTTAGTCTACTGCTGTCTTGG + Intronic
994792909 5:104254344-104254366 TTTGTATTCTGCAGCTTTATTGG + Intergenic
994906834 5:105851200-105851222 TTGGTATTCAACACCTGTATTGG + Intergenic
995222645 5:109668300-109668322 TTTTTTTTCCTCACCTGTTTTGG - Intergenic
997452722 5:133996379-133996401 TTTTCATTCCTCAGCTGGAATGG - Intronic
998972051 5:147603929-147603951 TTTTTAAACCTCAGCTGGATGGG + Intronic
999566743 5:152872127-152872149 TTTTTTTTCCCCAGCTTTAGTGG - Intergenic
1000213031 5:159127003-159127025 ATATTATTCCACAGGTCTATAGG + Intergenic
1000470051 5:161629888-161629910 TTATTCTTCCACAGCTTTGTTGG - Intronic
1000673081 5:164086756-164086778 TTATTATTTCACTGCTGCATGGG + Intergenic
1000964867 5:167644189-167644211 TTTTTATTCAACATGTGTACTGG - Intronic
1003699162 6:8443329-8443351 TTTTTATTTTACAGTTCTATAGG + Intergenic
1004377481 6:15103359-15103381 TTTTGAGTCCACAGCTTTCTTGG + Intergenic
1004661492 6:17714259-17714281 TTTGTATTGCACAGCTTTTTAGG - Intergenic
1006220852 6:32489901-32489923 TTCTTATTATACAGCTCTATGGG + Intergenic
1006368808 6:33632212-33632234 TTTCTCATCCACAGCTGAATGGG + Intronic
1008997511 6:57675836-57675858 TTATTATCCTACAGCTCTATAGG - Intergenic
1009380485 6:63022807-63022829 TTTTTGTTCTACAGCAGTATAGG - Intergenic
1010538886 6:77066855-77066877 TTTTTATTTCTCAGTTGTCTTGG + Intergenic
1011729097 6:90242138-90242160 TTTATGTTACACAGTTGTATGGG + Intronic
1013385572 6:109626769-109626791 TTTAAATGCTACAGCTGTATAGG + Intronic
1013916959 6:115352157-115352179 CTTTTATTCCACATCTTTATGGG - Intergenic
1014424915 6:121292055-121292077 TTTTTATTCTTCAGCTTAATAGG + Exonic
1014928248 6:127300832-127300854 TTATTATCTCACAGATGTATAGG - Intronic
1015608602 6:134988925-134988947 TTTTTTTTCAATAGCTGTAGAGG - Intronic
1015955555 6:138594553-138594575 TTTTCACTCCACAGATGTATGGG + Intronic
1017288018 6:152700992-152701014 GTATTATTCCACAACTATATAGG - Intronic
1017666884 6:156728380-156728402 TTTTTCTTCAGCAGCTTTATTGG + Intergenic
1018338318 6:162820313-162820335 TTTTTATTTCTCAGCAGCATTGG + Intronic
1018880599 6:167875706-167875728 TTTTTTTTTAAGAGCTGTATTGG - Intronic
1019422905 7:959241-959263 TTTTTATTACTGAGTTGTATGGG - Intronic
1020429755 7:8106881-8106903 TTTTTAGTGTACACCTGTATGGG + Intergenic
1020730260 7:11870538-11870560 TTTTGATTTCACAGGTTTATAGG + Intergenic
1020930910 7:14392841-14392863 TTCTTATTCCAAAGCTATCTTGG - Intronic
1021490352 7:21213189-21213211 TGTTTATTACACACCTGTACTGG + Intergenic
1022356337 7:29618290-29618312 TTTTTACTACACAGTTCTATAGG - Intergenic
1022707308 7:32815797-32815819 TGTTTATTCGACAGCCCTATGGG + Intergenic
1024611517 7:51068737-51068759 TTTATATTTCACAGCTTTATAGG - Intronic
1027981143 7:85223885-85223907 TTTTTTTTCAACAGCTTTTTTGG - Intergenic
1028225593 7:88248953-88248975 TGTGTATTCCACAGCTGTTGGGG + Intergenic
1029057234 7:97759753-97759775 TTATTATCTCACAGCTGTGTAGG - Intergenic
1030851690 7:114494520-114494542 TGTTTATTCCACAGTTTTCTTGG - Intronic
1031013979 7:116552485-116552507 TTTTAAAGCCACAGCTGTTTAGG - Intronic
1033630923 7:143156854-143156876 TTTTTATTCAACAGGTTTTTGGG - Intergenic
1033677008 7:143552609-143552631 GTTTTATTCCACTGTTGTATGGG + Intergenic
1033694827 7:143776828-143776850 GTTTTATTCCACTGTTGTATGGG - Intergenic
1034518167 7:151598224-151598246 TTTAGATTCCACAGATGAATGGG - Intronic
1035488431 7:159250562-159250584 TAATTATTCCACAGCTTTGTTGG - Intergenic
1037614477 8:20506269-20506291 TTTTTATTCCAGTGCAGTTTGGG + Intergenic
1040370268 8:46763867-46763889 TTATTATCTCACAGCTGTACAGG + Intergenic
1041511751 8:58660517-58660539 TTTTTATATAACAGCTTTATTGG + Intergenic
1041843193 8:62295595-62295617 TTTCTATTTCACAGCTTTTTTGG + Intronic
1043649083 8:82565223-82565245 TTTTTAATCTAAAACTGTATTGG + Intergenic
1043814129 8:84780677-84780699 TTTTTGTTCCTCAGCTTTTTGGG + Intronic
1044860800 8:96521656-96521678 TATTTATTTCACATCTGTGTCGG + Intronic
1045615868 8:103910301-103910323 TTTTTATCCCATACCTGTAGGGG + Exonic
1046017658 8:108624784-108624806 TTATTATTCCTTAACTGTATAGG + Intronic
1046670107 8:117047592-117047614 TTTTTACTTCTCAGCTGTAAAGG - Intronic
1050866762 9:10510335-10510357 TTTATAGTACACAGCTTTATGGG + Intronic
1050999633 9:12265188-12265210 TTTTTATTAGCTAGCTGTATAGG - Intergenic
1051864591 9:21665214-21665236 CTTTTATTTCCCAGATGTATAGG + Intergenic
1052238294 9:26240108-26240130 TTTTAATTCCACCTCTGCATTGG + Intergenic
1052296910 9:26907063-26907085 TTTTTATGCCACTGATTTATTGG - Intronic
1052597652 9:30580863-30580885 TTTCTATTACACAGGTGTGTAGG + Intergenic
1052675253 9:31614068-31614090 TTTCTCTTCAACAGCTGTTTGGG - Intergenic
1053853113 9:42309774-42309796 TTTTTTTTAAACAGCTTTATTGG - Intergenic
1055223921 9:73970615-73970637 TTTTGATTTCACAGGTTTATGGG + Intergenic
1055342404 9:75298036-75298058 TTTAAATAGCACAGCTGTATAGG - Intergenic
1055503188 9:76922203-76922225 TTTCTACTCCACAGCTTGATTGG - Intergenic
1055819662 9:80246517-80246539 TTTTTATTCCAAGACTGTTTTGG + Intergenic
1056228424 9:84519784-84519806 TTGTTTTTCCACAACTGTGTGGG - Intergenic
1056879000 9:90370868-90370890 TTTTTATTTCACAGCGATTTTGG - Intergenic
1056945323 9:90990260-90990282 CTTTTATTTCACAGGTGTGTAGG - Intergenic
1058063240 9:100521744-100521766 TTTTTATAACTCACCTGTATTGG - Intronic
1059296046 9:113271646-113271668 TTATTATTTCACAGTTTTATAGG - Intronic
1059321391 9:113473086-113473108 TCTTTTTTTAACAGCTGTATTGG - Intronic
1059614594 9:115935126-115935148 TTTTTCTTCTCCAGCTTTATTGG + Intergenic
1060037024 9:120264341-120264363 TTTTTTTTCCATAGCTTTAGGGG + Intergenic
1060334258 9:122706507-122706529 TCATGATTCCACAGCTGTACAGG + Intergenic
1187289089 X:17934810-17934832 TTTTTATGGCATAGCTGAATTGG + Intergenic
1188290797 X:28385948-28385970 TTATTTTTCCAAATCTGTATTGG - Intergenic
1188956475 X:36440137-36440159 TTTTTTTTCCACAGCATCATAGG - Intergenic
1189188368 X:39073399-39073421 TTCTAATTCCACAGCTGACTGGG - Intergenic
1191598777 X:62978305-62978327 TTTTTATTCTTCAGGGGTATTGG + Intergenic
1193171401 X:78340886-78340908 TTTGTTTTCCTCATCTGTATGGG + Intergenic
1193600449 X:83503848-83503870 TTCTTTTTCAAAAGCTGTATGGG - Intergenic
1193774677 X:85627494-85627516 TTTTTCTTCTATAGCTCTATGGG + Intergenic
1194107694 X:89792365-89792387 TTTTGATTTTACAGGTGTATAGG - Intergenic
1194500101 X:94672231-94672253 TTTTTATTTCACAGCTTTATAGG - Intergenic
1194620971 X:96171072-96171094 TTTTTATACCACAAAAGTATGGG + Intergenic
1194874491 X:99169820-99169842 TTTTTATTCAATAGCTGTAGAGG - Intergenic
1197379098 X:125716220-125716242 TTATTTTTTCACAGTTGTATAGG - Intergenic
1197632440 X:128876892-128876914 TTTTTATTCTTCTCCTGTATAGG - Intergenic
1197803020 X:130371988-130372010 TTTTTATTTCCCAGCTATTTTGG - Intronic
1199068645 X:143450466-143450488 TATTTATTCCACAGATGTTTGGG - Intergenic
1199518784 X:148711213-148711235 TTTTTTTTCCAGAGCTGAATTGG - Intronic
1200459651 Y:3440150-3440172 TTTTGATTTTACAGGTGTATAGG - Intergenic
1201726832 Y:17161447-17161469 TTTTCATTCCACTGCTGAAAAGG - Intergenic