ID: 1116018306

View in Genome Browser
Species Human (GRCh38)
Location 14:39432353-39432375
Sequence TCAGCGGCCCGGAAGCCTCA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 89}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116018302_1116018306 -7 Left 1116018302 14:39432337-39432359 CCCTCGCTCGTAAACTTCAGCGG 0: 1
1: 0
2: 0
3: 2
4: 15
Right 1116018306 14:39432353-39432375 TCAGCGGCCCGGAAGCCTCAAGG 0: 1
1: 0
2: 0
3: 11
4: 89
1116018304_1116018306 -8 Left 1116018304 14:39432338-39432360 CCTCGCTCGTAAACTTCAGCGGC 0: 1
1: 0
2: 0
3: 3
4: 13
Right 1116018306 14:39432353-39432375 TCAGCGGCCCGGAAGCCTCAAGG 0: 1
1: 0
2: 0
3: 11
4: 89
1116018301_1116018306 17 Left 1116018301 14:39432313-39432335 CCGGCACACTGAGTAACTGCACT 0: 1
1: 0
2: 0
3: 13
4: 103
Right 1116018306 14:39432353-39432375 TCAGCGGCCCGGAAGCCTCAAGG 0: 1
1: 0
2: 0
3: 11
4: 89
1116018300_1116018306 23 Left 1116018300 14:39432307-39432329 CCGAGGCCGGCACACTGAGTAAC 0: 1
1: 0
2: 0
3: 4
4: 58
Right 1116018306 14:39432353-39432375 TCAGCGGCCCGGAAGCCTCAAGG 0: 1
1: 0
2: 0
3: 11
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116018306 Original CRISPR TCAGCGGCCCGGAAGCCTCA AGG Exonic
900509957 1:3054101-3054123 TCAGCCTCCAGGCAGCCTCAAGG - Intergenic
901069250 1:6509102-6509124 TCAGTCCCCTGGAAGCCTCACGG + Intronic
906574620 1:46876630-46876652 TCAAAGGCAAGGAAGCCTCAGGG + Intergenic
906597352 1:47091274-47091296 TCAAAGGCAAGGAAGCCTCAGGG - Intronic
912855719 1:113167245-113167267 TCAGCGGCAAGGAATCCGCAAGG + Intergenic
915963121 1:160283556-160283578 TCTGGGGCCCCGAAGCATCAGGG + Exonic
923520142 1:234728933-234728955 TCAGTGGCCCCGACACCTCAGGG - Intergenic
923563284 1:235057994-235058016 TCAGGGGCCAGGAAGGCTCAGGG - Intergenic
924711666 1:246534605-246534627 TCAGTGGCAAGGAAGCCTCAGGG + Intergenic
924795294 1:247288442-247288464 TCAGGGGCCCTGCAGGCTCACGG + Intergenic
1069833383 10:71294380-71294402 TCAGCTTCCCAGAAGCCTCAGGG + Intronic
1070674943 10:78406029-78406051 TCAGCCACCCGGTATCCTCAGGG - Intergenic
1075070586 10:119317486-119317508 TCATTGGCCCGGACCCCTCAAGG + Intronic
1076986864 11:243662-243684 CCAACAGCCCGGAAGCCACAGGG + Intronic
1080759731 11:35236822-35236844 TCAGCAGTCTGGAAGCCTAATGG - Intergenic
1081543232 11:44051291-44051313 AAAGGGGCCCGGAAGCCACAAGG + Intronic
1084979002 11:72818804-72818826 TCAGAGGACTGGAAGCCCCATGG - Intronic
1092868696 12:12786921-12786943 CCGGCGGCCCGGGAGCCGCATGG + Exonic
1098383720 12:69896720-69896742 TCAGAGCCCCAGAAGCCACATGG - Intronic
1103563999 12:121806348-121806370 TCAGCGGTGGGGAAGCCTCCGGG - Intronic
1104450396 12:128864223-128864245 TCTTCAGCCCGGAAGCCTCTCGG - Intronic
1104483325 12:129127925-129127947 ACAGCTGCACAGAAGCCTCAGGG - Intronic
1105924527 13:24995771-24995793 TCAAAGGCAAGGAAGCCTCAAGG + Intergenic
1110107377 13:71694345-71694367 TCATAGGCCTGGAATCCTCACGG - Intronic
1111012402 13:82329025-82329047 TCAGTGGCAAGAAAGCCTCAGGG + Intergenic
1113794953 13:113051402-113051424 TCAGCGTCGTGGAAGCCTCACGG - Intronic
1116018306 14:39432353-39432375 TCAGCGGCCCGGAAGCCTCAAGG + Exonic
1121859018 14:97299001-97299023 TCACCGCGCCGGCAGCCTCACGG - Intergenic
1134490724 16:14693837-14693859 CCGGCAGCCCGGAAGCCTCCCGG - Intronic
1134496105 16:14732955-14732977 CCGGCAGCCCGGAAGCCTCCCGG - Intronic
1136264481 16:29107059-29107081 CCAGCAGCCCGGAAGCTTCCCGG - Intergenic
1138257357 16:55577900-55577922 TCAGGGGACCGGAAGCCAGATGG - Intronic
1140442520 16:74998930-74998952 TCAGCGGCCCAGGCGCCGCAGGG + Intronic
1141527210 16:84618765-84618787 TCTGCAGCCCTGCAGCCTCAGGG - Intergenic
1141764206 16:86047945-86047967 TCAGCAGCAAGAAAGCCTCATGG + Intergenic
1142720858 17:1774920-1774942 TCAGGGGCTCTGAGGCCTCAGGG - Intronic
1145293868 17:21573386-21573408 TCAGCGGCCTAGATGCCTCTTGG - Intronic
1147905007 17:43816924-43816946 TCAGTGGCACAGCAGCCTCAAGG + Intronic
1149156061 17:53631237-53631259 TCAAAGGCAAGGAAGCCTCAAGG + Intergenic
1150108718 17:62479440-62479462 TCAGCGACCCGCAGCCCTCAGGG - Intronic
1151550992 17:74822373-74822395 GCAGGGCCCCGGGAGCCTCAGGG - Intronic
1152492629 17:80647824-80647846 TCAGCTCCCTGGAAGCCCCACGG - Intronic
1152641956 17:81452931-81452953 CCAGCAGCCTGGAAGCCTCAGGG - Intronic
1153925755 18:9833331-9833353 ACAGGGGCCCGGAAGTGTCAGGG + Intronic
1157836403 18:50907248-50907270 TCAGCAGCCTGGAAGCCACCAGG - Intronic
1160868932 19:1268276-1268298 TCGGCGGCCCCAAAGCCTCTGGG - Intronic
1163687437 19:18719748-18719770 TCAGCCGCCCGCAGGCCTCTGGG - Intronic
1164062320 19:21686339-21686361 TCAGTGGCAAGGAAGCCCCAAGG + Intergenic
1165134622 19:33660015-33660037 TCAGGGGCCAGGAAGCCTGGTGG - Intronic
1166947365 19:46405249-46405271 CCAGCGGCCCTGGAGCCTCTTGG - Intergenic
925489480 2:4375824-4375846 TCACAGGCCTGGAAGCCTCAGGG - Intergenic
929393776 2:41499241-41499263 TCAGTGGCAAGGAAGTCTCAGGG + Intergenic
932773653 2:74514880-74514902 TGAGCGGCCCCGAAACCCCAGGG + Exonic
933368610 2:81387617-81387639 TCAGTGGCAAGAAAGCCTCAGGG + Intergenic
934538993 2:95159370-95159392 TCAGCTGCCCGGAAACAGCAGGG + Exonic
936243355 2:110806747-110806769 TCAGCGGCCAGGCAGGCTCCTGG + Intronic
937040582 2:118817640-118817662 TCAGCAGCCAGGAGCCCTCAGGG + Intergenic
937369682 2:121288550-121288572 TCAGCAGCCTGGAAGCCCCAGGG - Intergenic
937974860 2:127576528-127576550 TCTGAGGCCCTGAGGCCTCAGGG + Intronic
940989569 2:160084167-160084189 TCAGCAGCAATGAAGCCTCAGGG - Intergenic
948700641 2:239757564-239757586 TCCCCGGCCAGGCAGCCTCATGG + Intergenic
1171154791 20:22862078-22862100 GGAGCGGCGCTGAAGCCTCAGGG + Intergenic
1171259463 20:23718737-23718759 CCAGCTGCCCTGAAGCTTCATGG + Intergenic
1175193365 20:57225983-57226005 TCAGCAGCCCAGAAGCCCCCAGG + Intronic
1176237410 20:64060065-64060087 TCAACGTCCCAGAAGCATCAAGG - Intronic
1181376518 22:22462912-22462934 TCAAAGGCAAGGAAGCCTCAAGG - Intergenic
1181814793 22:25429907-25429929 TCAGGCCCCAGGAAGCCTCAGGG - Intergenic
1184692736 22:46124568-46124590 CCAGTGGCCAGGAAGCCTCTGGG - Intergenic
950645038 3:14371992-14372014 CCAGCAGCCCAGAAGCCTCTTGG + Intergenic
951052229 3:18106995-18107017 TGAGCTGCCTGGAAGCTTCAAGG - Intronic
961647392 3:128399960-128399982 TCAGCGGCCAGCCAGGCTCATGG - Intronic
963064914 3:141255956-141255978 TCAGCCCCCAGGAAGGCTCATGG + Intronic
965819804 3:172673715-172673737 TCAAAGGCAAGGAAGCCTCAAGG + Intronic
968907508 4:3461556-3461578 TCAGCAGCCCTGGAGCCGCATGG + Intergenic
973339013 4:48985839-48985861 CCAGCGCCCTGGAAGCCTTAGGG - Intergenic
979137463 4:117127805-117127827 TCACAGGCCCAGAAGCCTAAAGG + Intergenic
980649709 4:135696506-135696528 CCACCTGCCCGGAAGCCTCCCGG - Intergenic
982407192 4:155033733-155033755 ACAGCAGCTGGGAAGCCTCATGG - Intergenic
983062729 4:163176834-163176856 TCAGCAGCAAGAAAGCCTCAGGG + Intergenic
985217237 4:187666942-187666964 TCAGAGCCCAGAAAGCCTCACGG - Intergenic
1015953458 6:138576717-138576739 CCAGCGGGACGGAAGCCCCAGGG + Intronic
1017722865 6:157256358-157256380 ACAGTAGCCCAGAAGCCTCAAGG + Intergenic
1018080569 6:160256242-160256264 TCAGAGGCCCTGAAGGCTGATGG + Intronic
1018639234 6:165891479-165891501 TCAGCGTCCTGGAAACCTCATGG + Intronic
1024556385 7:50606439-50606461 TCACCGGCCCGGGAGCCCCGAGG + Intronic
1030621892 7:111799039-111799061 TCAAAGGCAAGGAAGCCTCAAGG + Intronic
1032037734 7:128531950-128531972 TCAGCGACCCGCAGCCCTCAGGG - Intergenic
1037904618 8:22708360-22708382 TCAGAGGCTCGGCAGCCCCAGGG - Intergenic
1042454462 8:68984543-68984565 TCAGGAGCCCAGAAACCTCAAGG - Intergenic
1042760546 8:72267501-72267523 TCAGCAGCAAGAAAGCCTCAGGG - Intergenic
1046610461 8:116417645-116417667 TCAGCTGCCCTGAAGTCTGAGGG - Intergenic
1050830032 9:9999047-9999069 TCAGCAGCAAGGAAGCCTCAAGG + Intronic
1057600168 9:96450588-96450610 TCAGCGGCCCGATAGCCCCGGGG + Exonic
1061730457 9:132610037-132610059 TCATCAGCTGGGAAGCCTCATGG + Intronic
1062139471 9:134947887-134947909 TCAGTGGCTCGGCAGCCTCGCGG + Intergenic
1186396469 X:9213638-9213660 TCAGCTGCTCAGAAGCCTAAAGG - Intergenic
1187840546 X:23482624-23482646 TCAGCAGCCAGGAGGCCTCGTGG + Intergenic
1190539198 X:51459694-51459716 TCAGAGGCAAGGAAGCCTCAAGG + Intergenic
1193560372 X:83010395-83010417 TCAGCAGCAAGAAAGCCTCAGGG - Intergenic
1194533240 X:95076264-95076286 TCAGTGGCAAGGAAGCCTCAAGG - Intergenic
1198837425 X:140819537-140819559 TCAAAGGCAAGGAAGCCTCAAGG - Intergenic