ID: 1116018817

View in Genome Browser
Species Human (GRCh38)
Location 14:39437294-39437316
Sequence GGAGTAGGCCTGACAATGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116018817_1116018823 17 Left 1116018817 14:39437294-39437316 CCTCCCATTGTCAGGCCTACTCC No data
Right 1116018823 14:39437334-39437356 ATTTTGATGTTAGATTCATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116018817 Original CRISPR GGAGTAGGCCTGACAATGGG AGG (reversed) Intergenic
No off target data available for this crispr