ID: 1116021582

View in Genome Browser
Species Human (GRCh38)
Location 14:39468618-39468640
Sequence CTCTGCCTGTGGAAAGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116021582_1116021595 30 Left 1116021582 14:39468618-39468640 CCCTCCACTTTCCACAGGCAGAG No data
Right 1116021595 14:39468671-39468693 GGCCTATGAGGAGTGCTGCCAGG 0: 2
1: 0
2: 14
3: 66
4: 280
1116021582_1116021592 18 Left 1116021582 14:39468618-39468640 CCCTCCACTTTCCACAGGCAGAG No data
Right 1116021592 14:39468659-39468681 ACCACCATCACTGGCCTATGAGG No data
1116021582_1116021591 9 Left 1116021582 14:39468618-39468640 CCCTCCACTTTCCACAGGCAGAG No data
Right 1116021591 14:39468650-39468672 CCTGTGGACACCACCATCACTGG No data
1116021582_1116021587 -7 Left 1116021582 14:39468618-39468640 CCCTCCACTTTCCACAGGCAGAG No data
Right 1116021587 14:39468634-39468656 GGCAGAGGATCCTAACCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116021582 Original CRISPR CTCTGCCTGTGGAAAGTGGA GGG (reversed) Intergenic
No off target data available for this crispr