ID: 1116027580

View in Genome Browser
Species Human (GRCh38)
Location 14:39534130-39534152
Sequence CCCAAACAGATATAGAGCGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116027580_1116027590 21 Left 1116027580 14:39534130-39534152 CCCTCGCTCTATATCTGTTTGGG No data
Right 1116027590 14:39534174-39534196 CCAGATGATGTCTGATCACCTGG No data
1116027580_1116027591 22 Left 1116027580 14:39534130-39534152 CCCTCGCTCTATATCTGTTTGGG No data
Right 1116027591 14:39534175-39534197 CAGATGATGTCTGATCACCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116027580 Original CRISPR CCCAAACAGATATAGAGCGA GGG (reversed) Intergenic
No off target data available for this crispr