ID: 1116030791

View in Genome Browser
Species Human (GRCh38)
Location 14:39568755-39568777
Sequence CACATTTTGCAGAGGGAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1116030786_1116030791 19 Left 1116030786 14:39568713-39568735 CCATTCTAAAGCAATCAGAGTTG No data
Right 1116030791 14:39568755-39568777 CACATTTTGCAGAGGGAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1116030791 Original CRISPR CACATTTTGCAGAGGGAGAA GGG Intergenic
No off target data available for this crispr