ID: 1116030791 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 14:39568755-39568777 |
| Sequence | CACATTTTGCAGAGGGAGAA GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1116030786_1116030791 | 19 | Left | 1116030786 | 14:39568713-39568735 | CCATTCTAAAGCAATCAGAGTTG | No data | ||
| Right | 1116030791 | 14:39568755-39568777 | CACATTTTGCAGAGGGAGAAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1116030791 | Original CRISPR | CACATTTTGCAGAGGGAGAA GGG | Intergenic | ||
| No off target data available for this crispr | |||||